--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (6059 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (4 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        674        778   0   Terminal    105    68    Marginal
ctgggggatgaggtggaggtgggggatataatataggagatggtacagtgcaggggcaga
ggctggtgtgttctccaggacaagtggcaccacgcactgaaagacttttcaagataaaca
caactttgtctcttcagcctggcaagagctgaggcactgaaaacttcttttttcccctag
AAAATGACACACTCTCCTCCTAAGGGTCCCTTTGATTTTGTCCTGGTGGAAAGCAACAAA
GAGAAGAACGTGAACAGGAATATGTATATTTCAGTTGTCATCTGA
gtcccatggataggaggctcaattctcttcttcatctttcagatctccgcagaccctgcc
ctctcactgtacaattcagagattgacactcagcaggcattcaataaacgtctgtgtcaa
atgagaacaacttgatggggcaagtaggagtcaatcctgcatccctccctcccttttttt

Exon  2 +       1288       1407   0     Single    120    84        Good
ccttgttcaaacagcacttacaggtggggacctgtttttgctaagtcatcctggggatgc
tcaaagctccattgttagatcctttctgtcctccttcctggctcctccttcctccccacc
cctctaataggctcataagtgggctcaggcctctctgcggggctcactctgcgcttcacc
ATGGCTTTCATTGCCAAGTCCTTCTATGACCTCAGTGCCATCAGCCTGGATGGGGAGAAG
GTAGATTTCAATACGTTCCGGGGCAGGGCCGTGCTGATTGAGAATGTGGCTTCGCTCTGA

ggcacaaccacccgggacttcacccagctcaacgagctgcaatgccgctttcccaggcgc
ctggtggtccttggcttcccttgcaaccaatttggacatcaggtgaggggtccctccttg
taatgcaccaaaagtgttgggttggtgtagctcaggtgggataaaaggagaggctgaatg

Exon  3 +       4176       4514   0   Internal    339    98   Excellent
cttgagcccagaagttcaaggctgcagtgagcaacacctcgtctgtcttgtctctctctc
tttcacagtgaaaaagaatgaccctggggagggagtgtaggagggtgaaagagtttcatg
ttgtggatctttctcttcccccacccactgtccacgcactttgtctttttcctcccctag
GAGAACTGTCAGAATGAGGAGATCCTGAACAGTCTCAAGTATGTCCGTCCTGGGGGTGGA
TACCAGCCCACCTTCACCCTTGTCCAAAAATGTGAGGTGAATGGGCAGAACGAGCATCCT
GTCTTCGCCTACCTGAAGGACAAGCTCCCCTACCCTTATGATGACCCATTTTCCCTCATG
ACCGATCCCAAGCTCATCATTTGGAGCCCTGTGCGCCGCTCAGATGTGGCCTGGAACTTT
GAGAAGTTCCTCATAGGGCCGGAGGGAGAGCCCTTCCGACGCTACAGCCGCACCTTCCCA
ACCATCAACATTGAGCCTGACATCAAGCGCCTCCTTAAA
gttgccatatagatgtgaactgctcaacacacagatctcctactccatccagtcctgagg
agccttaggatgcagcatgccttcaggagacactgctggacctcagcattcccttgatat
cagtccccttcactgcagagccttgcctttcccctctgcctgtttccttttcctctccca

Exon  4 +       5637       5672   0    Initial     36    90   Excellent
gcggatcacttgaggtcaggagttcgagaccagcctggccaacatgatgaaactctgtct
gtactaaaaatacaaaaaattagccaggtgtggtggcgcacgcctgtaatcccagctact
caggaggctgaggtgagagactcatttgaacccgggaggtggaggctgcagtgagccaag
ATGGCGGCGCCACTACACTCCAGCCTGGGCGACAGA
gtgagactccgtctcaaaataaataaataaagttcacattacaccctcattcttctcaaa
atcacatattcacaaattcaggctccagacaaatagaggcaggaatgactggactcattt
cttcctctgtaagaaggaaggggttggggatgggagagagcctcccttcagagtcaggct

--------------------------------------------------------------------------------