--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (63194 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (11 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1349       1736   0    Initial    388    63    Marginal
gcgcggccgggctttccagcctgtggccgctcccggctcggagtgtgatctaagcaggtt
gcgtaccttcctcaggtgactccggccacagcccattgtccgcggccaccggcggagttt
agccgcagacctcgaagcgccccggggtccttcccgaacggcagcggctgcggcgggtcc
ATGGAGAAGGGCCCTGTGCGGGCACCGGCGGAGAAGCCGCGGGGCGCCAGGTGCAGCAAT
GGGTTCCCCGAGCGGGATCCGCCGCGGCCCGGGCCCAGCAGGCCGGCGGAGAAGCCCCCG
CGGCCCGAGGCCAAGAGCGCGCAGCCCGCGGACGGCTGGAAGGGCGAGCGGCCCCGCAGC
GAGGAGGATAACGAGCTGAACCTCCCTAACCTGGCAGCCGCCTACTCGTCCATCCTGAGC
TCGCTGGGCGAGAACCCCCAGCGGCAAGGGCTGCTCAAGACGCCCTGGAGGGCGGCCTCG
GCCATGCAGTTCTTCACCAAGGGCTACCAGGAGACCATCTCAGGTCAGTGCGCCCGCGGG
CTGCTAGAGCGTGCGGGCGGCGGGGGCG
gtgcttgcaggaaacgcgcgccggctccaggaagtttccggagttgcctcacttttggcg
caggaagccgggcgctgtcacctccgaacccgccctagcctgccgccctgccgaggccct
gcgtggggcacagtcggggcttcctgggtggcagcgacctctcagccccggaactcgctg

Exon  2 +       7565       7676   0   Internal    112   100   Excellent
aaacttctatgtaggttttataggcataattgtgtgtgtgtgcactggctccagatgtaa
aatgcatttcttactgtaggttgtagtcaaaagtttgaaagcctgtatctaggggatctg
tttaaggatttaatatttcttttttttttttaaagagatatataattaaagagaagacag
AGTAGTGAGAACAAGGATGATGCTGAACTTAAAGGAATGAACCTGAAATGTGGTGGGGTC
TTGGACCAACCTGGATGGCAGGGAGAAGGAAGGATACTGGTGGGAGATAGGA
gtgagtgggaacccacatctttaggtccataaacgcttctgcacaatcccttttatttct
ttagagagcatgagtcaagtggccactatatattgtttttggataagaacatacttctct
gaaggtcacttttctgtgcttgtaaacaggatacaggactttatatcttttatatatctg

Exon  3 +       8694       8777   0    Initial     84    48    Marginal
cagacagcattatctaccaaggattaaatgggtataacttgttccatcagttgtttttta
tgagtttttgggaatatgcaagagtcttgactctgtcacatttccagttaaagtaggttt
tagcttgtctgccaagacagtttttataaatcatgttaacagttcaaaattttgggaagc
ATGCATATAATCCAGCGTGAGGAGATGGCATTGGAGATGGCTGACTGCTTCCCTGTGAGG
GCTGAGGAAGCACAGACACTGGCA
gtgagtcatatccccacctcagccattttcactggaagattatgtctattcgctaaagat
aatgggaggcaattagatactttgtttatacaaaaatgcatcttagacacttcatactga
aatgtagcaatcacaaaaggtttttctttttgaatcacaaacctctcggatttattaaat

Exon  4 +      17801      17977   0     Single    177    66    Marginal
atccaccggcctcggcctcccaaagtgcggggattacaggcatgagccaccgcgcccggc
ctataactggttttgactaatgcgagttgtggtagggcttgaaagaaatcacaaactaaa
tgtaaaatttaatttgaaaaatgctgtccaagcaggaactcacatccaggaacaaaatga
ATGGAGACCAGAAATCCAGATATGTATGCCCAAGAAAAGCAGAATTTTATCCAGGACTTC
TCCCAGGTTGTCAGGATGCTGACTGAGGATGAGATGGGGCACCCAGAGACAGGAGAGTCT
ATTACCTGGCTCAAAGAGGTCCTGGAGTACACTGCCACTGGAGACAAGTACCACTAG
ggtttgatgatgctggtagcattccaggagctggcagagcccaggaaacaggatgctgat
agtctccagcaggtcctgtctgggctgttgtgtgaactgctgtaagcttgcccgtttttt
tttgttgttgttgttgtttgttttttgagatggagcctagctctgccgcccaggatggag

Exon  5 +      25731      25809   2   Terminal     79    83        Good
tgagttgatttaattccagccaaaagcagaggtgtgatgccctaggcacttctctctgtc
tcttctcttaattttaaaaccagtaggcagactccattagctctttcctatcctttagga
tggatgctcactcagatgttccaagtcatcttccactgtcttttaactctgtccttccag
GGAGATGCGTCAGGTGTCCGGCTTCCTCAGAGAGCTGGAGTTGTTGGTGCTGATCACCAG
ATACTCCAGACGGCACTAA
ttcctatactatgggttcagagggaactccattggacagaaatttccttttgaggaaatc
tttccctggagtttcttcttacctttttccctcactttctccacagcagaaacaggtctg
tttgtccttaaatatttacctatatatttgagtaggagcattttgaagagatgaagtttc

Exon  6 +      28813      28858   2   Terminal     46    88        Good
tttcttctagggtttttatggttttaggtctaacgtttaagtgtttaatccatcttgaat
taatttttgtataaggtgtaaggaagggatccagtttcagctttctacatatggctggcc
agcttttccagcaccatttattaaacagggattcctttccccatttcttgtttttgtcag
GTTTGTCAAAGATCGGATGGTTGTAGATATGCGGCATTACTTCTGA
gggctgtgttctgttccattggtctatatctctgttttggtaccagtaccatgctgtttt
ggttactgtagccttgtagtatagtttgaagtcaggtagcgtgatgcctccagctttgtt
cttttggcttaggattgacttggcaatgcggtctcttttttggttccatatgaactttaa

Exon  7 +      38576      38685   1   Internal    110    90   Excellent
ttacttacagaaaaggactttgctactttgataaggaaaaatatctagttttaatttgta
ttcccttaatattttagggaggattaacgttcgtttatgttgactgtctattcatgttta
tccataattctacctttctataaaattggacatgttactaaagcaagcctctgatttcag
ATGTCCTAAACGATGCTATATTTGATGAAGATCATGATGAGATGGTGATTGTGAAGGACA
TAGACATGTTTTCCATGTGTGAGCATCACTTGGTTCCATTTGTTGGAAAG
gtaaggttctctttgttgtttcccagcaatttaaaacatagtgaaagtttttcaattaga
ataattatatttaaaatttttagctgccaattgctgatatctcaggtatttacaattata
catatatggttattctttattaacctgactaataacttgaaacttaaaaaacaaaaccaa

Exon  8 +      55006      55092   0   Terminal     87    65    Marginal
cactcagtaaaaatctatgggaatgttcctcctgccatgagagcagctgtctgccagaag
caggcaggcactgtgggtggtagtgaaatcctagaggcattcctattgaagtgtggagca
aaacatggttgcccagtgttaccactattgtccaatgtggcacctgaagttctactccag
AAAAAGAATGGTGAATACGAGAAGGAAAACATTACTAACTTTAAAATCAATGGCATCTCC
TACATATATAACAAACTAATCACCTGA
aaaactatcagaagtaatatatacagaaatttgacctagtaagaaatatgacatacctcc
tatctaggagcttaaaaaccattcctttctaaggttttgttcaaaataccaatagaatat
agctattaatatatttcttcaatatcctagtaactactgctgggataaaggagagctagg

Exon  9 +      58095      58244   2   Internal    150    89        Good
agtgatgctggagggcttcagggtgttctgagatctctttagccctgtacttcaggtgag
ggagttgaatccgggcctctctgtggcccagtcagcagacaaagcagtctggtaaaagct
ggtgtgtcttggctcttaaatctcacagaagtctgatttttaagatttcaaatgttctag
AGACAGAAAAAGCTTCCAGCTGTTTGTGTCAGACTCTCAAACTGAGCTCCTTATCACATC
CACAGTTCAGGAGCGCCTTACAAAACAAATTGCTGTAGCAATCACGGAAGCCTTGCGGCC
TGCTGGAGTCGGGGTAGTGGTTGAAGCAAC
gtaagtctgcatctgcctttagtaacgtcataatggtgcactagaagtgatcttgctatt
tagtgcttctcatattttgtagcaccaggtgatgccacacaactgatatgataactgtag
atttccatccctgagcctaaagctcttttaccactttcatttactgttactgatatagga

Exon 10 +      60958      61144   1   Internal    187    96   Excellent
acttagtactcacactgcaaataactagtcagctcagttttaactttataggtttattga
gtttcctttgtgtgatccatgtagatgcctcaaaatgtttcttcttcttcttttttttaa
tcttataagatatttttctaagtatttccagaaacatttgagagtgcccatcattttcag
GTCTGCAGAACCATAGCTTCCACGCACCTGAACGAGCACAGAATGAACTGACGGTGGAAG
ACATTATGAGCTGTGTCCAACGTTTTAACCAAAGCGTATCGTACCAACGATCTGTGAAAA
TGCACTGGAAGCTTCTGGTCCCGGTTTCCTTTGTGGTCTATGTGGGTCTTGTCCTCATTG
TAACTCC
gtatagatggtataggtattttaatcctggaagctgttgccttattaatgattatcttaa
aatttcctccattggggcagcgtgggccaaattaaaacaaacaaaaccgcaactcctcca
cagaaacacaaacacagttattccatgaagtttagtatttggttgacatagtgctcttca

Exon 11 +      62830      62909   2   Internal     80    93   Excellent
ataaaacattcctagaaccaccactcataggtgtcaataaaacgatgagctgctcagcta
agcccgagttgctgcttctgagttttgtcaccgaagattgattggccaagttccttttca
cttagtggaagagcagttgcagacatgaaaggttttcaagaagcctttctgtcaaaacag
AGCACCTGGATTCATCATCACAGGCATGGGTCCTCCTGCTGATGGAGAGAAGAAGAAGTC
TCAAGAGATCAAGGGGAAGT
gtgagtacctgactcctcaccctcccagaggcccttgccttcttttaatttttgttacag
aaaatgaaacatgcacatcagtagagagatgagcacatgaacccctgtgtactaatcacc
cagcttcaagaagtctcaactcaatggcgccatcttgttttcctctatacccatctgacc

--------------------------------------------------------------------------------