--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (5782 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (4 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1356       1496   0    Initial    141    88        Good
cagtggctgcggcgcctcgtactccaaccgcatctgcagcgagcatctgagaagccaaga
ctgagccggcggccgcggcgcagcgaacgagcagtgaccgtgctcctacccagctctgct
ccacagcgcccacctgtctccgcccctcggcccctcgcccggctttgcctaaccgccacg
ATGATGTTCTCGGGCTTCAACGCAGACTACGAGGCGTCATCCTCCCGCTGCAGCAGCGCG
TCCCCGGCCGGGGATAGCCTCTCTTACTACCACTCACCCGCAGACTCCTTCTCCAGCATG
GGCTCGCCTGTCAACGCGCAG
gtaaggctggcttcccgtcgccgcggggccgggggcttggggtcgcggaggaggagacac
cgggcgggacgctccagtagatgagtagggggctcccttgtgcctggagggaggctgccg
tggccggagcggtgccggctcgggggctcgggacttgctctgagcgcacgcacgcttgcc

Exon  2 +       2250       2501   0   Internal    252    98   Excellent
gctgcggaatgcctgggaggaaaagggggagacctttcatccaggatgagggacatttaa
gatgaaatgtccgtggcaggatcgtttctcttcactgctgcatgcggcactgggaactcg
ccccacctgtgtccggaacctgctcgctcacgtcggctttccccttctgttttgttctag
GACTTCTGCACGGACCTGGCCGTCTCCAGTGCCAACTTCATTCCCACGGTCACTGCCATC
TCGACCAGTCCGGACCTGCAGTGGCTGGTGCAGCCCGCCCTCGTCTCCTCCGTGGCCCCA
TCGCAGACCAGAGCCCCTCACCCTTTCGGAGTCCCCGCCCCCTCCGCTGGGGCTTACTCC
AGGGCTGGCGTTGTGAAGACCATGACAGGAGGCCGAGCGCAGAGCATTGGCAGGAGGGGC
AAGGTGGAACAG
gtgaggaactctagcgtactcttcctgggaatgtgggggctgggtgggaagcagccccgg
agatgcaggagcccagtacagaggatgaagccactgatggggctggctgcacatccgtaa
ctgggagccctggctccaagcccattccatcccaactcagactctgagtctcaccctaag

Exon  3 +       2933       3040   0   Internal    108    98   Excellent
gctgaggatcttattttaaatgcaagtcacacctagtctgcaactgcaggtcagaaatgg
tttcacagtggggtgccaggaagcagggaagctgcaggagccagttctactggggtgggt
gaatggaggtgatggcagacacttttactgaatgtcggtctttttttgtgattattctag
TTATCTCCAGAAGAAGAAGAGAAAAGGAGAATCCGAAGGGAAAGGAATAAGATGGCTGCA
GCCAAATGCCGCAACCGGAGGAGGGAGCTGACTGATACACTCCAAGCG
gtaggtactctgtgggttgctcctttttaaaacttaaggggaaagttggagattgagcat
aagggcccttgagtaagactgtgtcttatgctttcctttatccctctgtatacaggagac
agaccaactagaagatgagaagtctgctttgcagaccgagattgccaacctgctgaagga

Exon  4 +       3156       3797   0   Terminal    642    93   Excellent
ggaataagatggctgcagccaaatgccgcaaccggaggagggagctgactgatacactcc
aagcggtaggtactctgtgggttgctcctttttaaaacttaaggggaaagttggagattg
agcataagggcccttgagtaagactgtgtcttatgctttcctttatccctctgtatacag
GAGACAGACCAACTAGAAGATGAGAAGTCTGCTTTGCAGACCGAGATTGCCAACCTGCTG
AAGGAGAAGGAAAAACTAGAGTTCATCCTGGCAGCTCACCGACCTGCCTGCAAGATCCCT
GATGACCTGGGCTTCCCAGAAGAGATGTCTGTGGCTTCCCTTGATCTGACTGGGGGCCTG
CCAGAGGTTGCCACCCCGGAGTCTGAGGAGGCCTTCACCCTGCCTCTCCTCAATGACCCT
GAGCCCAAGCCCTCAGTGGAACCTGTCAAGAGCATCAGCAGCATGGAGCTGAAGACCGAG
CCCTTTGATGACTTCCTGTTCCCAGCATCATCCAGGCCCAGTGGCTCTGAGACAGCCCGC
TCCGTGCCAGACATGGACCTATCTGGGTCCTTCTATGCAGCAGACTGGGAGCCTCTGCAC
AGTGGCTCCCTGGGGATGGGGCCCATGGCCACAGAGCTGGAGCCCCTGTGCACTCCGGTG
GTCACCTGTACTCCCAGCTGCACTGCTTACACGTCTTCCTTCGTCTTCACCTACCCCGAG
GCTGACTCCTTCCCCAGCTGTGCAGCTGCCCACCGCAAGGGCAGCAGCAGCAATGAGCCT
TCCTCTGACTCGCTCAGCTCACCCACGCTGCTGGCCCTGTGA
gggggcagggaaggggaggcagccggcacccacaagtgccactgcccgagctggtgcatt
acagagaggagaaacacatcttccctagagggttcctgtagacctagggaggaccttatc
tgtgcgtgaaacacaccaggctgtgggcctcaaggacttgaaagcatccatgtgtggact

--------------------------------------------------------------------------------