--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (13421 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        726        826   0   Internal    101    83        Good
gcatgacacagatttagcaactgagcataaataatttgactcggatactgctccaaaatc
cgaagaggaccaatttcttccaggaggacaactacctcgtcctctgcagacccctctcct
cggcagctgaaggagtgtggccaatctgcctccacctccccgcggaccccctactctcag
GACCTCCTGCAGCACCCCAAACTGGAAGTGGCCGCTGCAGACCCAAGGACGAGGGGCACG
CGGGAGCCGGCAGCCCTAGTGGAGCGGTTGGAGATGTTGAG
gtgggagggtcacccaggtggggtgaggctggggtaggtagcggagtgaacggcttccga
agctctgggccgcccccaggttggactaagcaggcgctctgtcttcgcccccgcccaggg
tgggcgtctcctgaggactccccgccacacctgacccgagaccgcgcgcccagcctagaa

Exon  2 +       2337       2406   2   Internal     70    61    Marginal
gcttgttcctgccgctttcgcaccctgcggccccccacccagtgcagcagtgcgggcggg
cgtgagcctcggtgcaccaggaggcacttcccgcgggaggcgctgggctcgcgctaattg
gggcggggggggggggcggcgggggaggagggaactggcgcgcggcttggtttccattag
AGACGCAAAGTTTCTGCTCCGGGAGGAGGCGGCGGCGCCGCGGGCTCGTCGCCTGGGGGA
GCAGAAGCGG
gtgggaggtgcgggtggccttggcctcagccctggtgcgcgggggccgggggtggtgacc
ctcctggccgaggaggggcggcgtccagacgcccgctcgggggccgccttcccccccacg
cctgcccccgggcacgcgccctgcccggtccctcgccccgcgccacttccagtccgcaga

Exon  3 +       3250       3330   0    Initial     81    53    Marginal
gaacaccattcctactgttaaagttttcacttaagagtataaacttcatcagctttctat
taggacttattttgtaattggcttcttaggcatccttctttaaaagagaaatccacgtta
gctctccttgaggtctcgagttccctcggctggaggcacaggttcagtggagaccaaata
ATGCAGGTGAATTACCTTCGTGGCCATTACTGCCTCCAACGAAGTGTGTTTATTAAGAAC
AGTTCTTATGTCATTCTTAAG
gtaggtagggttaatactctccagcaaatttagtagatactctttgccagaaaagagagg
agtatatatagtttgataattattgtgtagttttctgtgtacttaatttttgcagttttg
taacacttcatttgtaagatggtaccattttttcctggcttctgaatcataggatagttt

Exon  4 +       3711       3812   0   Internal    102    72        Good
gtaatggtaggcttttaacaaataactgcctaatttaaaggattggaaagcatttgttac
atggaaatgaagttggtggcgtacccagttgctgtatctttattttttctacttaattat
ttctcataaaatggatataaaagcctgttaatccaacccaatgccattatgtaacgccag
TTTGGAGATTTCGAGGGCCTGGAGCAGTGCGCAAGGTGCGCTGAAAGCCTGCCCCTGGAT
GAGATCCTTATCCTGGCTGTGATGGCAGTGGCAGTGGGCTGG
gtcccttgttgagtggaaagggggactgcggtgtccatggtgcagtaggtggcgctcttc
tgtcttagagcctgccgccactgcagctggtgccaaggggccttctgccactagaggtgc
catttttcacatgatgaacttagcctagttagatcgcagagcaagctgtaagccatgggc

Exon  5 +       5174       5377   0   Terminal    204    69    Marginal
ttgaagggggcacatggaccaatcttgtcagattggatttagtcccttgaacctgggagg
caggggttgtagtgagctgagattgcaccactgcactccaatctcggtgacagagcgaga
ctccattgtttaaaaaaaaaaaaaaagattggatttaggactaatttaagcatgttccag
CTTAGCCGCCTTGAAACCTTTGGGAATATTGTGGTGTGTGGCACTGTTTATTGGGAGCAG
TGTTTGCTTTATGGGCTGCTGTATGAAGGCCAGTCCAACAGGACTATTGTGGTCATTATT
TCAGTAGATAAAGACCAGACTTCTGATACGTTGCACAACTTGAATGGCTGGCTTTGGCAA
GCCCCCGGCAAGTGTGTATTGTGA
ctgggttggataaagacattgattctaacgggtcaacttttgttttcagaattcaaggaa
gccttctccctatttgataaagatggcgatggcaccatcacaacaaaggaacttggaact
gtcatgaggtcactgggtcagaacccaacagaagctgaattgcaggatatgatcaatgaa

Exon  6 +       5427       5570   1   Internal    144   100   Excellent
ggctgctgtatgaaggccagtccaacaggactattgtggtcattatttcagtagataaag
accagacttctgatacgttgcacaacttgaatggctggctttggcaagcccccggcaagt
gtgtattgtgactgggttggataaagacattgattctaacgggtcaacttttgttttcag
AATTCAAGGAAGCCTTCTCCCTATTTGATAAAGATGGCGATGGCACCATCACAACAAAGG
AACTTGGAACTGTCATGAGGTCACTGGGTCAGAACCCAACAGAAGCTGAATTGCAGGATA
TGATCAATGAAGTGGATGCTGATG
gtaagagctttaaaaccatgaatgagggccattgttgtgtaattcaagttcagacatgtt
acaggattgtctttcaggtccccagagcaaagcaaatgtgcaaagatcctttctgtggtt
gccccagggccattgacaattaaaatagaagatgatgggccttgcgtccatcctgcttag

Exon  7 +       8065       8136   0    Initial     72    56    Marginal
tgcagatgattgaacctagtaagatagtctgcccctttgtcctagtacatgtttaccgtt
ccgtacagtggttctgaaatgattactgcagagcagcgttaatggagtgcttactttaca
tgagctttttgttttttaattcgaggtaatggcaccattgacttccccgaatttttgact
ATGATGGCTAGAAAAATGAAAGATACAGATAGTGAAGAAGAAATCCGTGAGGCATTCCGA
GTCTTTGACAAG
gtaatccagcatctacatagcagatggtacttaagtatggcttcttccgctttcacttct
aaaagctataataatgttatagacagaagacttaaatctaactgcctgagcctctgatct
cactttcaaaaatcctccttatggtaaccgtatcaggggagggtaggcataataaatagg

Exon  8 +       8547       8682   0   Internal    136    91   Excellent
gcaaatcctgttttctgcattagctgtttgcatgtatttagtaggttagaggtgggaact
agagatcagagaattgtttatggcagcagagttagcagtaacttgagagggcatagctaa
gtcaaagacctacttccccacactacatcattagcaataacaattgctgaatgttcacag
GATGGCAATGGTTATATCAGTGCAGCAGAACTACGTCACGTCATGACAAACTTAGGAGAA
AAACTAACAGATGAAGAAGTAGATGAAATGATCAGAGAAGCAGATATTGATGGAGACGGA
CAAGTCAACTATGAAG
gtaaaactaaattctctgagctcagtgtttcatagtcttacctttagatctgtaagcaag
ccaactgcttcactagacagcctttgactttattttatgtacagtaaagatgttgtgttc
attaaagctgttttcaaagataaccaaaagttactattatatttgtcttttcagaattcg

Exon  9 +      11224      11303   0    Initial     80    44    Marginal
gacccagtctcaggcctgtggtcgatgacctctcggtagtttcaaagggggctggagggg
gatatttgacttgttttttcgaaatgtagccttctaaccctcaagtctttagaagctggg
tggactcttagtggtcctgcagcgtatcctaaaagactacctttgaaacaggattcttgt
ATGGCCAGGATCCTGTCTGGGAACCAGAAACCCTACACCCTCCCCCTCCAGGGAATGCTG
AGTTCCAGTTTTGAGCAGAG
gtgaggcagaatccactgtagccttccgccctggtatttggggggatgaccagcccaggc
gttgggtgttagtctgcatgagtttgtgagaggaaatagctgggtgtcctggcagtgccc
ttgaagttggttaggaccttcctgtaaactcttgcccctacttctaactactctataaat

Exon 10 +      13113      13217   2   Internal    105    62    Marginal
ggctgcctgcttctgccccctttgcttccagaaaggccttttccagctgcctcgtgtgtt
tcccactctgcccagaaggagtgagagggctgaaaagcggggcgggataaggccctgctt
tcgacagaaggcttgagacacatctccagaaagcatttaaagagcccctcctgcacatag
GAGCTGGGACTATAAGGACATGGTCATCACCGTGGAGACGGCCCTCTGCTCTGAGGCTTT
AGACCTGGCTTCTGGATTTGGTTCTGTCCCTCCAGCCTCAGGCAG
gttctttacctttcccaggccttggtatcctccttggtaagatcatattggacttggtac
cttctgcctgtggctttctaggattatgaccgacctggtttggcatcactttgtgtttag
atagatgaaattgcagcctaaaggatgggaggcaaaattgtgtaggagtgctgtgtcctt

--------------------------------------------------------------------------------