--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (104598 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (14 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1468       1525   0    Initial     58    56    Marginal
ggaggaagagagggaaagagaggaagggaaaaaaaacaccaacccgggcagaggaggagg
tgcggcggcggcggcggcggcggcagcggcggcagcggcgcggcggcggctcggaccccc
tcccccggctccccccatcagtgcagctctccgggcgatgccagaatagatgccggggca
ATGTCCCGCCGCAAACAGGGCAACCCGCAGCACTTGTCCCAGAGGGAGCTCATCACCC
gtaagtgtctgcggagtgcgcgcgaggggccggagatggggctccgggcgtctggggctg
gggacaccgagcccggaacagccgagcctggccaggcgccggggccgcccgctggctggc
agagtctacggcgtcggcctggagcatggcggggggcgggggccataggaaagtttcttt

Exon  2 +      14847      15282   1   Internal    436    84        Good
tgtcctgtgggggatgctcaccagcccccaaccccggggaggacctggtgagctctggca
gccagcagcagagggggctgcttcttggcggggaaggggtggaccggaagttgggtgctg
tgaccgcctaagcccatctctatcttctctgccccttccctttcttctttctgtctccag
CAGAGGCTGACCATGTGGAGGCCGCCATCCTCGAAGAAGACGAGGGTCTGGAGATAGAGG
AGCCAAGTGGCCTGGGGCTGATGGTGGGTGGCCCCGACCCTGACCTGCTCACCTGTGGCC
AGTGTCAAATGAACTTCCCCTTGGGGGACATCCTGGTTTTTATAGAGCACAAAAGGAAGC
AGTGTGGCGGCAGCTTGGGTGCCTGCTATGACAAGGCCCTGGACAAGGACAGCCCGCCAC
CCTCCTCACGCTCCGAGCTCAGGAAAGTGTCCGAGCCGGTGGAGATCGGGATCCAAGTCA
CCCCCGACGAAGATGACCACCTGCTCTCACCCACGAAAGGCATCTGTCCCAAGCAGGAGA
ACATTGCAGGTATGGGATGCTGCGCTTGCCTGGTTGCTGTGGAAGCCACCTCCTGGGTCC
CATGCCCTCTGCCTGA
gtgtgctggtgcaggggaaggcccaggggcttccaggatggcctctgggccaccagccgg
ggctccccctttctgagggtccaccatccaggtgaccttcaggaggagacaggcctgggg
ctcggggaggcccaaatggctgatggctgcttgcttttggtgaggggactctgtctcggg

Exon  3 +      29187      29283   2   Internal     97   100   Excellent
gctggagcgtcaggggccgtgtcgttgttaaagccgcagaatctagaggttggcatgtgg
tgtcggatagtctcgaatgcattgacttcctaaacagcccagggcaaaccagttcatctg
ttagttgcttcatctataaaatggggctagccaattgtttacttccctgtccctgtccag
ATATGAAAACAAACCCATAGGTAGGAGTGAAGCAATTGCTGATTTCAAAGACATCATAAA
AATGGAGAACTGTTATTGTTCAGTCCGTGGGGGCAGG
gtgactaatttgcaaaagggaaaggaatcaaatagcctcttctagagggtgtaatttttt
actgcaaggaagaagaattaggggctttgggaggaggtttatgtggggaggggggcactt
ggtttttcaatttagtaacctgataccaataggaaactcccccacttccccattcatttt

Exon  4 +      38815      38930   0   Internal    116    97   Excellent
tttgggcttttgcagtagcttcagatttcttgagttccacccttgggaagggctctgggt
ttgagctgccccgtgtggaaacctctcccagtgtagaaggtgctctgggagccccagaga
ggccctgtagagcttgggatttgaagcccctctcccggctgcccccctcccctgcctcag
TTGAGCCGGTCCCTGGAGCAGGTGGACTTCAGCAAGGTCACAATTGCTAATGAGACTCTG
GGGAAACCTGTCCAGGGCGGCCTACCCCCTGACCCCTATGCAGGGAACAACGTGTG
gtgtgtgacatcgcctttacagaccctggtctgagccccaccttggacgtttccaggaga
agggtgtggccagatgcctgttttctacctgctctgcaacggttcctcccaccacggaga
cagagtcagcttcttagcacctgggacaacccttaccaggcctcgagctgcttctgctgg

Exon  5 +      42193      42325   2   Terminal    133    53    Marginal
attctacagatgggcagatgggccggtgtggtgacacaaactggcctctacctgccctgc
ttctccccaagtggaacccaagatcttattctgcctagggtctctgggaatccttggggt
ccttgggaattcaagggcaaagggccctctcacaagtctgtccccccggcatctcggcag
GGCCTGGCGTGAAAGCACTGTGGCCACGCAAACCAGGATGCTGACACAGACACATGTGGT
GAGCAGCCGTGGCCTGGTTTCTGTGGCAGGGGCAGGAAAGGAGAAGGGGGGTGCAGAGCT
GGGGCAGATTTGA
ttggtccctgctttgtcaccaggcatgttgcaggctttctctcgacttgaattgtgaaag
gaaaactatttttattgggcaggttgtgtttttaattgaagctgtccccacaggcggtcc
ctgatggagccacagctctgcaaaagccatggccacagctctgtaaaaggccacaggcag

Exon  6 +      73660      73743   0    Initial     84    52    Marginal
accttcggtttgtagcagtttttattaggctggtcacggtaattaccaggacgtggatca
gggaggaaaagcgaataattcggtaatgaacatttttattcattatctcacattttcagg
aagcggacaagtatcgcaaaagtatcagtgatgcttcctttctgtttgtttttttaaaaa
ATGATTGTTTTGGACAACGGCCCCGCGCAAAGCGTCCCTCGCCGTGAGCAAGTGGTGTCC
GGGGAGTCTGAGCTAGGCGCTCTG
gtgtgtcacggggctggggtgcacctggggatggctgacctagtctgcctgggaggaatg
cagagagtcggaagcctgctagccccattcgccgaagagttttctaaaaccattgattaa
gtggaaagttttttgctgtgctgaccgggggtggggtggaacaggtattcttgtgtctta

Exon  7 +      73965      74118   2   Terminal    154    66    Marginal
agtctgcctgggaggaatgcagagagtcggaagcctgctagccccattcgccgaagagtt
ttctaaaaccattgattaagtggaaagttttttgctgtgctgaccgggggtggggtggaa
caggtattcttgtgtcttaggattagcccagatggggctgttctggtgagtgcaaagcag
TGCATTTCGGAAGGTGCGGAAGGTGCGGAAGGTGCACTCTGTTTGGAAGGCTGGGGGTAT
GGCTGAGAATGTGTCGCGAGACCTTTCATACCATTCAATCCAGGAATTCTACTTCCAGGA
CCACGGCCTGAAGACTAACCAGGGACACGCATAG
gctcatacgtatacacctgcagcgtccctataatcatggaaaagagagtggtgaaataaa
catgccccagccatagggtggaacatcacccagcaattgaaaataatgatgtcagggcac
ttctagcgatgtgggaaaatgtcaagcacaaatcaaaactgtatacagcaggagctcagc

Exon  8 +      76322      76422   2   Internal    101    58    Marginal
gaccttaggttttcaacccactgggaacagctttgaccaggatagttggggacacggagc
tatctccctgaaagatgggctggctggcctggctcaggaggggaaggggaggatgccagg
acattgaggtcctcatgttggaggagtggccggtgcacccccagcccctgtttttttcag
GTCCACAGAAGGTATCACGGTGCTGCGCCCCAGTCACCACTATGATCAGAACACTGCTGT
CCTCACTCGTGTGGAGGAACTTTGGAACCTTTCCTCCCCTG
gttgcctggttacaagatcatctgtcatgtgttccctgagaagagggcttggctggggag
acgtgggctggggggcagcattgggagatggtgtttgcctttgggaatgcaacaagcacc
ttcgattctatctaattcccatttatattatgccggacagccccaccacccagctgccct

Exon  9 +      78235      78356   2   Internal    122    52    Marginal
cattttgcagacaaggcctttcacaccgaaggacagattcagagaagttaagcaccttcc
ccagggttgcccagctaataactgccgagtcatagctggttgggaatagaaccccatagt
gttcagtcctttgttcaaggtgcatgggcaacactggatggggttctgggtgccccacag
GGCAGAAGCCGAGAAGGACAGAGCTCTGGCCATGCCTACAGGCATCTTCCTGGCCCTGCC
ACCCCCTAGGGATGTTGTCCAGGAGCACTGGCTCCTTGGCGGGCCCATCTTACCAGAACT
GG
gtgtgttctgtaagccagtgcagtccggggaaggccttggcggtttgctgactgtgactt
ctgctgctgggggacagtccggggccagcagcacttgctctgtgctggggctgtgaggag
ggaggacaggtgtccaggtggtcgccctgtcacctgccctgagcttcctgatatttcgtc

Exon 10 +      83763      83976   0    Initial    214    43    Marginal
tgctgtagccttaggctgagtactttatttgccatctgcgtcggcccaaaatcccccggg
gaagcgctaaaatattctgaataaactcagctcgagttcttattgagagtaaaataccat
ttgtggcacgtcgtattgattcgtcttaattgtggtgcagaaaagaacattcactggctg
ATGACTTTTGTGCTCGGTGACAAGCTGGCTGGAGTTACTCTAGCACTGCAGTTGGTTAAC
CTGGGCCGACAGCAGACTCGGCCAGGCGGGCACCTGGGCTCCAGCCGCGGGAGCCGCAGC
GCCACCCCCCGCCCCAAGCCGGTGGTACAGCTGGGGCTCCCCACCAGCCCCTGGCCCTCC
TCCCGGGAGAGGGTTGGGGAGAAGGGAGCCCACT
gtggggggcagaggaaattcacaccctgcccctcagacctctccctatggccagccttgt
ccttccccagaaagacgaactgacctgctggggacagaggccacggtttcagcctcagcc
ctagccccagccccagccccagccccagccccagccccagccccagccccaggccagcca

Exon 11 +      89494      89515   0    Initial     22    60    Marginal
cctgtcctcaaggagcttggagtctggaagatgaattttaaataaataagctaaggtcac
taatttcttcttgagcaacttatccaagttctctgggcttcccttatttcttcggtcaat
ggtcactgcgtgtagagttaggtggggtctaaacgaggtgatgtgggtgggtctggcatc
ATGTGGGTTCTGAACCCCCAAG
gtgagtcaaacccttgaattcttctctctcccagcaccctgaactcctcctagcgtcact
cataatttgcattaaataatggagtggttactgggggttccctgtctcccccctggagtg
tgagctgcacccttagctaccagcatagtacctagcagatgaagggggcccagatcctgt

Exon 12 +      95325      95439   0    Initial    115    56    Marginal
agtgcaatgctgcaagacgggtcctgtctgcaccgtctcttttatgcagagcattaggag
aggtacatactggaaaagcggcgagcttcacccccaggtgcaggagggcacttgcaggat
gggttccggaggaaatgttcagcctccattttgtgattgtctcagtgatggacacagacg
ATGACGTTTTGGCTCCATACCACGAGTGTTCGCTACAATTTGCTGCCCGTGTCACCAGAG
CCAGTTGCTAACACATCAGCATTTGCCACTGTTCATCCTGACTGCCCTGTCAGAT
gtgaggatgttctttcattgcttagtattctggcagaggactttgaaagactcatgtagg
ccagtgtgcccccgccttccctggggtctggaggtggaattccaagcggtgtttgggcgt
gtgtgtgaggacacggggtgggggcagctgtcacagtagtagccggtcttcacagcatgt

Exon 13 +      96491      98505   1   Internal   2015    88        Good
ccagccaggaggagacaaggccgggcctgcttgcaagcggccctgcagcccctgtcaggc
agggcactgggatcccggatcagcccgggccgcgtcccccaggccagtggccctgcggtg
cccgcgccccgctgccgcttctcacgctgtctctgcctttctgtccgtgtgtttccccag
GTAAAGATGAGCCTTCCAGCTACATTTGCACAACATGCAAGCAGCCCTTCAACAGCGCGT
GGTTCCTGCTGCAGCACGCGCAGAACACGCACGGCTTCCGCATCTACCTGGAGCCCGGGC
CGGCCAGCAGCTCGCTCACGCCGCGGCTCACCATCCCGCCGCCGCTCGGGCCGGAGGCCG
TGGCGCAGTCCCCGCTCATGAATTTCCTGGGCGACAGCAACCCCTTCAACCTGCTGCGCA
TGACGGGCCCCATCCTGCGGGACCACCCGGGCTTCGGCGAGGGCCGCCTGCCGGGCACGC
CGCCTCTCTTCAGTCCCCCGCCGCGCCACCACCTGGACCCGCACCGCCTCAGTGCCGAGG
AGATGGGGCTCGTCGCCCAGCACCCCAGTGCCTTCGACCGAGTCATGCGCCTGAACCCCA
TGGCCATCGACTCGCCCGCCATGGACTTCTCGCGGCGGCTCCGCGAGCTGGCGGGCAACA
GCTCCACGCCGCCGCCCGTGTCCCCGGGCCGCGGCAACCCTATGCACCGGCTCCTGAACC
CCTTCCAGCCCAGCCCCAAGTCCCCGTTCCTGAGCACGCCGCCGCTGCCGCCCATGCCCC
CTGGCGGCACGCCGCCCCCGCAGCCGCCAGCCAAGAGCAAGTCGTGCGAGTTCTGCGGCA
AGACCTTCAAGTTCCAGAGCAATCTCATCGTGCACCGGCGCAGTCACACGGGCGAGAAGC
CCTACAAGTGCCAGCTGTGCGACCACGCGTGCTCGCAGGCCAGCAAGCTCAAGCGCCACA
TGAAGACGCACATGCACAAGGCCGGCTCGCTGGCCGGCCGCTCCGACGACGGGCTCTCGG
CCGCCAGCTCCCCCGAGCCCGGCACCAGCGAGCTGGCGGGCGAGGGCCTCAAGGCGGCCG
ACGGTGACTTCCGCCACCACGAGAGCGACCCGTCGCTGGGCCACGAGCCGGAGGAGGAGG
ACGAGGAGGAGGAGGAGGAGGAGGAGGAGCTGCTACTGGAGAACGAGAGCCGGCCCGAGT
CGAGCTTCAGCATGGACTCGGAGCTGAGCCGCAACCGCGAGAACGGCGGTGGTGGGGTGC
CCGGGGTCCCGGGCGCGGGGGGCGGCGCGGCCAAGGCGCTGGCTGACGAGAAGGCGCTGG
TGCTGGGCAAGGTCATGGAGAACGTGGGCCTAGGCGCACTGCCGCAGTACGGCGAGCTCC
TGGCCGACAAGCAGAAGCGCGGCGCCTTCCTGAAGCGTGCGGCGGGCGGCGGGGACGCGG
GCGACGACGACGACGCGGGCGGCTGCGGGGACGCGGGCGCGGGCGGCGCGGTCAACGGGC
GCGGGGGCGGCTTCGCGCCAGGCACCGAGCCCTTCCCCGGGCTCTTCCCGCGCAAGCCCG
CGCCGCTGCCCAGCCCCGGGCTCAACAGCGCCGCCAAGCGCATCAAGGTGGAGAAGGACC
TGGAGCTGCCGCCCGCCGCGCTCATCCCGTCCGAGAACGTGTACTCGCAGTGGCTGGTGG
GCTACGCGGCGTCGCGGCACTTCATGAAGGACCCCTTCCTGGGCTTCACGGACGCACGAC
AGTCGCCCTTCGCCACGTCGTCCGAGCACTCGTCCGAGAACGGCAGCCTGCGCTTCTCCA
CGCCGCCCGGGGACCTGCTGGACGGCGGCCTCTCGGGCCGCAGCGGCACGGCCAGCGGAG
GCAGCACCCCGCACCTGGGCGGCCCGGGCCCCGGGCGGCCCAGCTCCAAGGAGGGCCGCC
GCAGCGACACGTGCGAGTACTGCGGCAAGGTGTTCAAGAACTGCAGCAACTTGACGGTGC
ACCGGCGGAGCCACACCGGCGAGCGGCCTTACAAGTGCGAGCTGTGCAACTACGCGTGCG
CGCAGAGCAGCAAGCTCACGCGCCACATGAAGACGCACGGGCAGATCGGCAAGGAGGTGT
ACCGCTGCGACATCTGCCAGATGCCCTTCAGCGTCTACAGCACCCTGGAGAAACACATGA
AAAAGTGGCACGGCGAGCACTTGCTGACTAACGAC
gtcaaaatcgagcaggccgagaggagctaagcgcgcgggccccggcgccccgcacctgta
cagtggaaccgttgccaaccgagagaatgctgacctgacttgcctccgtgtcaccgccac
cccgcaccccgcgtgtccccggggcccaggggaggcggcactccaacctaacctgtgtct

Exon 14 +     101659     101784   0     Single    126    54    Marginal
gagaaccgttcgtgttgggcttctctctgaacgccccgaaccttgcatcaaggctccttg
gtgtggccacagcagaccagatgggaaattatttgtgttgagtggaaaaaaatcagtttt
tgtaaagatgtcagtaacattccacatcgtcctccctttctctaagaggccatctctaag
ATGTCAGATGTAGAGGAGAGAGAGCGAGAGAACATCTTCCTTCTCTACCATCACTCCTGT
GGCGGTCACCACCACCACCTCTCCCGCCCTTACCAGCAGAAAGCAATGCAAACTGAGCTG
CTTTAG
tccttgagaaattgtgaaacaaacacaaatatcataaaaggagctggtgattcagctggg
tccaggtgaagtgacctgctgttgagaccggtacaaattggatttcaggaaggagactcc
atcacagccaggacctttcgtgccatggagagtgttggcctcttgtctttcttccctgct

--------------------------------------------------------------------------------