Gene UBL3 Variant 1
DNA : 85.24 KbNT_024524
mRNA : 3308 bp NM_007106
CDS : 354 bp NP_009037
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  135 bp
gtcctggggctgctgctgctgttgacgacgacgacgacgacgggggctgcctctgctgtc
ccgggagtttcctcctgctccggccacacagctcctggggattgttcctcttcgaaccag
aacctcggcctgaccggcactttggctccaaaataactttatttttgggggagaaagcac
ATCACGAACCAGTCAAAATCGTGGTTTATTTCTGTAACGTGAAGACTTCTGCTCTTTTTT
CTTTGTTTGTTTTTTTCGTAAACATCTGGGTGTATATCAAACGGCAAGATGTCCAGTAAT
GTCCCGGCGGATATG
gtaagtgacggataagttatgacactgatttaattgtggtttccaatcttatttaatcgg
aaagacggcaggcgtggggcgaagatttgctggggactgtcgaaaagccactgtgctgag
cgatttggagaagttggagcttctggtttcccccttttaggaagtactgcttttaatatg
EXON 2  109 bp
aaataaaatcaaatatcaaattcccattctttttaaaaaagttttatagaatttaaataa
aaaccacaatatggcattggtaataatttaggatgtgattgaaatgaaaagcctttgagt
cttcttttttacttaaaaaatttttagatttatgttaaaagaatcattgtcttctttcag
ATAAATTTGCGCCTCATTTTGGTAAGCGGAAAAACAAAAGAGTTCCTGTTTTCTCCTAAC
GATTCTGCTTCTGACATTGCAAAGCATGTATATGACAATTGGCCAATGG
gtgagtgatatttttctcttgagtatgaataatgttgattcttatgccctaccttgtctc
acaaacattttgaaactgttatataacatttaaaagaacaaccgaaaattgagagtataa
ggctcagatttagaggatcattgtacccttccttatcttgctcttcagcagtctcattcc
EXON 3  87 bp
aataagtaataaccaaggttgcggtaaatgtatgaatagtgactgtttctaatagtagta
ggaagctccaagggccttctttgtactctaactgatttggatctgaatttttaaaacaat
atagtagtaccttaattatatgttggaatatacctaaccagtacactggattcttttcag
ACTGGGAAGAAGAGCAGGTCAGCAGTCCAAATATTCTACGACTTATTTATCAAGGACGAT
TTCTACATGGAAATGTCACATTAGGAG
gtaacagccacctttgtaatgggatttaatgtctgtctcatggtagcatgattcgcttgt
tttaaatgttaatgtctttgaatttgctaaaaaaaatgataaattcaaactatgaattct
gcctatttctggtatgcctactccttcacattgtatattctgttaaatttagttttagga
EXON 4  78 bp
taaattttaaatgttatttctgataatattaacctaattttgtgaaggtactctgagtta
agttgaatctgttaaagaagtcataaaaaagcaatcaatttttaaaatggttttaaatct
ggatagtgattttaataggtcgatatatgtgtaactaatcatcttttgcttttcacatag
CATTAAAACTTCCTTTTGGCAAAACAACAGTGATGCATTTGGTGGCCAGAGAGACATTAC
CAGAGCCAAACTCTCAAG
gtaagccatgcactggaaaagtatctcagttgaggcacaaagacaggcattcaaaaatgc
taggtttttcttggatatgctgagggaagggaagtttgcatagtttatgaatagagattg
tcaagcaaataaccagacatttttgaaacatgctaaaattaaaagaacatttattacagc
EXON 5  2899 bp
aaccagacatttttgaaacatgctaaaattaaaagaacatttattacagcttcttaattt
tgaaaaatgcaaacatttttaaaaactcaaaactactacttcctacacttgattgcctag
cccattttcccctccagttctagaatttttataaacgaggctcttcttcgttttccctag
GTCAGAGGAATCGTGAGAAGACTGGAGAGAGTAATTGTTGTGTAATCCTGTAAACACTGT
CTGCCTAGTGTGATGTGATATAGTCTTTGTCTTTCATGCTGCTGGGACAGAAAAGACCCG
ACATTGCTTCAGAAACCGTTCAGAACAGTCTGCCTGTAAACACATGGAACTGAATTACCA
CATGAACACTGTCATCTTTTCTCATGAAAGTAAAAAGAACCAAGAACATTTTTCACTCTG
ATTTTTTATTTCTTGTATTTTTTGTTGAGCTGTTTTAACACATATTGGTTTTTGAATGCA
GTCAATCTCCAGGGGAAAAGTTAACAAGTTATCTTTCGTAGCAGAAACCATTTTGCTGCC
ACAAAATTTTCATCATCAGAACTAATAAATCAAGTGTTCCAAATACAATTTGCATTAAAA
AGATTGGCATTATTTTCCTCATCAGCAGAATTTATAACAGTGTGTGGTATCTAGAAATAC
TTATATATACAATTCCACACTGGAAGACACTCAGCAATTAATGAAGTTAATTACTGGGCC
AACTTGAGAGGAAAAAATGGAAAAGAAACTAAAATGTTGGGTGAATTCTACCAAAGTCAG
CCGTGGTGGCTGCACTGGCACAGAATACTAAACTGAGTGTGACTATTTTCACTGCAACAA
ATGAAAAAACAAAATGTGCCTGTTTAAAGCACTCAGTAGAGGGCTGATGAAACTAATTTT
TTTTCCTTTAAGACATGCACTCTTGAGTCCTACAGTAACTGAGTGTTTGTTTAGACAGCA
CAAGAAGGGGTGAGAGTGCGTCTCCTAGCCTTAATGTGGGAGGGTAGTTTCAGTCACTCA
TCGGCTTTCATTATTGTGCAGAAATATTAGAAAACCTCATTGATCAATTTTATGTATTTG
AATATCAGCAAATTGAAATTTTCCATAATTATCATTAATTTGTAACCACATCCAGTGTCA
TGCTTACTCCTTAGAGTTCAGATGAATTCTTAAAATTAAAAAAAAACTCCATAGTACTAA
TTTTGTTTCTTTATATAGTTTGCGTTTGATATTAGTGCTTGCAATTGTATTAAAGTCAAA
AGCTGATTTTTATGGCATACACAAGAATGCCACTTTTTCTTTTATTTCATACCAATAATT
TAAAGATTGATATGCTAAAAACAATTTGCACAGCACTAAAGCATGAGCTACTTTCATCTA
AACCTGTAAAAATATGAAAGATTTTTATATTTTTTCACTGGGAAGAAATTCTTCCTGGAT
GAAATTACAAATATGTGTAGAATATATTTAATAAAAGACTTATAAAATACCTAACTACAG
GACTTAAAATATAGATTGGCGCGTAGTATACAGAACAATATTCCATATAAATAAGTTTAG
CCTTTATAAAAATGAAGTTGCAGGCTGACATTACATTCTGTACTAAGTGTCAACAGCCCT
TACAAACATTAAATGTAAATGGTTTCAAATGGTCAGCGTTGTTTAAATGTAATCATGTTA
TTTTATTCATTGTTAATGCTTTGATGAAAAGGCTTTATATGCAGTAGATCTACGAAAATA
TTGTTCATACTGATCAGAATTAAATTTGTATAGAGCAGAGTTTTAAAATGAATGTAAATA
GCACTAAACGTTTTCTTTCTGCAACCTGTACTTACAGATTCTTCCTGTAAACTAAATAAA
AAAAAAATGATAGTGCATTTTGGTGGTAATTTTAAAGGTCTTGATTAGGTCAATAATTGT
TTAAGCACCGTCTCATTCATGTTTTCTACTTTCATTTCTTAAGCTTTTAAAATTCATTTA
ATTAATATTCTGTTGTTGTTTTGGGGAGTATTCCCAATGTATCTTTGATATTTAACCTGG
TTAATTTGTGGACAGTCACAACAATGGATAGAATTATGTAGTCTCCGTTATCACTAAAAT
GTTATCTTCAAGAGATGTTAAATATTTATATGCTTTGTTGACTAGCTGAAATGTGAATTC
TGTTAGTGTTGACTAAAGAATCTGGTAGTTGCTTAATTGGGCAATTAAACAATTTATGGC
TCTATTTTGTAAAACAAACTACTGGTAATTATTTTTAATACCTATTTTCATTCTGATTAC
TCTTTTTTTAAGTTAAAGACTATCAGTTAATTAAGATTGAGTTTTTATGATGGTTAAAAA
TAATTCTCTATTGGTTTTTCAATATATTTTTCTGTGTGTTCTCAGATTATATATTTCCCT
CAATTTAGAGTTTGCTAAGTGAAATAAACTGGTTCACTAGTAGAGAAAGAATTACGTCGC
TTAATACCTAATATCATAGTTGTACAATATGAAAAAAAAGAATAAAAAGTAGCAGTAAAA
TTATATACTGAAAACACCAAAAATTTAGATGCCTTAATAGTATATACGTGAAATACTCAG
CTGTCCCTTTAAAAATAATTCCTTGGACTGCCTGGTGGTTAAAATACGATTCCTCATATC
CAAGGCTACTTTTGAAGATCCCTCTGCCAAAAATATAGCTCACTTATCTAAAGGTGAGAG
CTGCATAGATCCAGTAATGTACATAAAGCCTGAATGATGAGCCTATGTCCCTGCCTAACG
CTGGTGTCTCACTCATCTCTTTTACCTAAATTGTCCTGAACTTTGTTAAGTGTTCTGGAC
AAGGCCAAGCTTTTCTTTATTAAAACCTCAGCATGTCTCCCTGATCTGAACTATTTGCTT
TCTCTTCAAGATAAGTTGTATTTTACCATGGAAAAATACAGTATCTAACATTACCATTCA
CGTTAAATGAAGTTTCCTCATAACATTTATCTTTAGTTTTATGAAGTCATCGTGACCAAT
GTTACAGTAATTTCTGTTAGCTGATTGTGGTAAACAATGTTTAATGTGAAAAGAAATTAA
AACTTTCTTCATCTGTTGT
agaatatttctcttctttaaaatggcttctattcataattctggtgtatttgcctattct
ttatttcactactgtttatgtctttttttctttcttcagttaatgatactcttcagtaaa
aatcaacattgagccagcctttgctatagtttagcaaaatcaaagggaagtatcagccaa