Gene RB1 Variant 1
DNA : 178.11 KbNT_024524
mRNA : 4740 bp NM_000321
CDS : 2787 bp NP_000312
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  275 bp
cgccaggtttcccagtttaattcctcatgacttagcgtcccagcccgcgcaccgaccagc
gccccagttccccacagacgccggcgggcccgggagcctcgcggacgtgacgccgcgggc
ggaagtgacgttttcccgcggttggacgcggcgctcagttgccgggcgggggagggcgcg
TCCGGTTTTTCTCAGGGGACGTTGAAATTATTTTTGTAACGGGAGTCGGGAGAGGACGGG
GCGTGCCCCGACGTGCGCGCGCGTCGTCCTCCCCGGCGCTCCTCCACAGCTCGCTGGCTC
CCGCCGCGGAAAGGCGTCATGCCGCCCAAAACCCCCCGAAAAACGGCCGCCACCGCCGCC
GCTGCCGCCGCGGAACCCCCGGCACCGCCGCCGCCGCCCCCTCCTGAGGAGGACCCAGAG
CAGGACAGCGGCCCGGAGGACCTGCCTCTCGTCAG
gtgagcgagcagagccgccgtcgcctcacgcgggaagggcgccccgggtgtgcgtagggc
gggcgccaaggcggctcggcggggatccgtcctcgccaggggccgggtcccggcgggagg
aggcgccctccctgccccccgccacggcggagcgtctgcagaatggtgacaggattctgg
EXON 2  127 bp
aagataatcatatgtttaaatttgaagtgtaatgtttttctaagataaaataagatctta
aagtatttaataatgttctttttcacagtagtgttatgtgcaaactattgaaacaagtat
gtactgaatcaatttgatttataagtatatgccaattatatgattattttcatttggtag
GCTTGAGTTTGAAGAAACAGAAGAACCTGATTTTACTGCATTATGTCAGAAATTAAAGAT
ACCAGATCATGTCAGAGAGAGAGCTTGGTTAACTTGGGAGAAAGTTTCATCTGTGGATGG
AGTATTG
gtaaggattttcttaaaacgttttgaaatttttttttctcattttaaaaacaacttcaaa
tcactatacaaaaattgaaagatagaaaaatataaagacaataaaagctaataataattc
cattacccagaggaaatttacctctgctaacattaaaaatgtttgaggccgggcacggtg
EXON 3  116 bp
agtgtgaaatgaaatcctttcaaatatatgccatcagaaggatgtgttacaaatatacag
tattacaaacatttattttgtatgctgaataagaaaaaatcagttataatacagttttaa
catagtatccagtgtgtgaattatttaatgaaatatttgatctttattttttgttcccag
GGAGGTTATATTCAAAAGAAAAAGGAACTGTGGGGAATCTGTATCTTTATTGCAGCAGTT
GACCTAGATGAGATGTCGTTCACTTTTACTGAGCTACAGAAAAACATAGAAATCAG
gtaaagtttcttgtataaatataagcctctgccataaaaggaaacgaattctggattttc
ctctcaatagacttttgtgaattagtgagaaatgctaaaataaagtaaaacaaaaagaac
ttggaccaaatagtgaactgccattctctcatggagccgttatgaaagtgtatttatgct
EXON 4  120 bp
taatagaggtgtaagttgaaggctaattatttttgcaaaaagtaattccttccaaaggat
atagtagtgatttgatgtagagctgataatcttttgaattgaaatatctatgatttgaaa
acgaaataacacaaatttttaaggttactgatttacttttttctattctttcctttgtag
TGTCCATAAATTCTTTAACTTACTAAAAGAAATTGATACCAGTACCAAAGTTGATAATGC
TATGTCAAGACTGTTGAAGAAGTATGATGTATTGTTTGCACTCTTCAGCAAATTGGAAAG

gtaaagtaaacattttattaggtttacactctgattttttatgtcattgttcacaattag
attctgggaattatttaacacatttagtaaagttagtaagtattaattcttagacttgtc
ccttttaatgttagctcattaattcttagctttcttatttatccagtaatatgcattctg
EXON 5  39 bp
taaagtgatgtgagatgtcataaattgggaaaatctacttgaactttgttttataatgct
atatattttttgtttttaaaatatatacttcttaaaagaagataaataaagcatgagaaa
actactatgacttctaaattacgaaaaaatgttaaaaagtcataatgtttttcttttcag
GACATGTGAACTTATATATTTGACACAACCCAGCAGTTC
gtaagtagttcacagaatgttatttttcacttaaaaaaaaagatttttatggaataatct
caaacatcttgatagttagggttagtttgatcgattatagcaggctacttcataaattaa
gcccatagatttaagtcctgtgtagattatttatcttctcacaaagaaaatagtataaaa
EXON 6  68 bp
aatagagataaactcaggtgtaaattatgcaattaaaatggactgcattctattatgcat
ttaactaaggtcattttttttttaatgcacaaaaagaaacacccaaaagatatatctgga
aaactttctttcagtgatacatttttcctgttttttttctgctttctatttgtttaatag
GATATCTACTGAAATAAATTCTGCATTGGTGCTAAAAGTTTCTTGGATCACATTTTTATT
AGCTAAAG
gtaagttcattatatttattaaatgctaatatttcaaatgtaataattaaattggcattc
ctttggactaaattccccaatttttattgagtaatgtactcctccctcattctctgcttg
gcttattaactgttagcaagttcctataattctggtactagaaacaaccttggaaatgct
EXON 7  111 bp
tattttataccttttaaaacagattttttttttttttacaaaaaaaagaaagaaaatctt
taccatgctgatagtgattgttgaatgaataaatttatggatatactctaccctgcgatt
ttctctcatacaaagatctgaatctctaactttctttaaaaatgtacatttttttttcag
GGGAAGTATTACAAATGGAAGATGATCTGGTGATTTCATTTCAGTTAATGCTATGTGTCC
TTGACTATTTTATTAAACTCTCACCTCCCATGTTGCTCAAAGAACCATATA
gtaagtatttaatttatgccccttttactttctcattcagcagttgcttattgaatgtct
agtgggtaccaaacatggttctaaggctgacaggatgataaaaaataaatcagacatgga
ctttgcccataagtagtgtaagttatagaaggaaagataagacatggaaacaaatgatta
EXON 8  143 bp
aatattagtacataatttgtagtagatatggatgaaattgttatccttctaatgaaacct
aataagtaaaagtagtagaatgttaccaagattatttttgacctaagttatagttagaat
acttcattattttatatgatggatgtacaattgttcttatctaatttaccacttttacag
AAACAGCTGTTATACCCATTAATGGTTCACCTCGAACACCCAGGCGAGGTCAGAACAGGA
GTGCACGGATAGCAAAACAACTAGAAAATGATACAAGAATTATTGAAGTTCTCTGTAAAG
AACATGAATGTAATATAGATGAG
gtaatttaacttcatgatttctttaaaacagttaaagtagatttagatgtaagttctccc
taacaatatttacttcttttgttatgagcatgttttttttgtaattagtgctaactcttt
tgcagtagcaaaatatttagaaaaaattaattcgttatatttagttactttgattttaaa
EXON 9  78 bp
gcctaggcaatatagagagaccccttctctaagaaaataataaaaaataaaaaagttata
cacagattttttactgcatgggggattgacacctctaacttaccctgcattgttcaagag
tcaagagattagattttgttttaaattttaatgatcatgttgtaacttcatctttttcag
GTGAAAAATGTTTATTTCAAAAATTTTATACCTTTTATGAATTCTCTTGGACTTGTAACA
TCTAATGGACTTCCAGAG
gtaatctgaaaggaaatttaataaaatattaatgttttgagactgtggagggaggataat
tgtctaactttcttagatcaatttactgtgtatcacattttttttttgcccaagaagaat
ctagccaagtagaattgtggtgaaactaacttttgtatagtaacaaaaagcttttgagta
EXON 10  110 bp
gttgcaattttctgtacctcacttttagatagaccttatttatattgcatgcgaactcag
tgtatattacaaaattaaatgtatattatacaaaaattctttaatgaaatctgtgcctct
gtgtgctgagagatgtaatgacatgtaaaggataattgtcagtgacttttttctttcaag
GTTGAAAATCTTTCTAAACGATACGAAGAAATTTATCTTAAAAATAAAGATCTAGATGCA
AGATTATTTTTGGATCATGATAAAACTCTTCAGACTGATTCTATAGACAG
gtattgcacatggtatatttgattgatttgctttagatataggttgatactgatataggt
agattatatagtctttagcttagtgacctttagatatcatttataacaaattactttcaa
atgtctttatacaaagaaaagtttaacagtattttaagcatataacttatctacaaatat
EXON 11  78 bp
gtagtgaaaaatattttatttaagcagcagctgggtcatctattttctatcctatctatt
attgagttatcattttatatgattttatgagacaacagaagcattatactgcttttttga
tgcataaagcacaaattgtaaattttcagtatgtgaatgacttcacttattgttatttag
TTTTGAAACACAGAGAACACCACGAAAAAGTAACCTTGATGAAGAGGTGAATGTAATTCC
TCCACACACTCCAGTTAG
gtatgaattttcctacttttaattatattataattttgttattcatggctttatagtgtt
tcagatttgttcacgtttctttatgtattcatacatacatgtaagaaatatatattgaag
gccaggtgtggtggatcacacctgtaatcccagcactttgggaggccaaggcgggcagat
EXON 12  88 bp
ttaaagatttaagtaaaatgtaatttcttataaaccacagtcttatttgagggaatgtag
agacaagtgggaggcagtgtatttgaagatacatttaacttgggagatggaaaacatttc
attttttctttttttctcccttcattgcttaacacattttcctatttttatcccctctag
GACTGTTATGAACACTATCCAACAATTAATGATGATTTTAAATTCAGCAAGTGATCAACC
TTCAGAAAATCTGATTTCCTATTTTAAC
gtaagccatatatgaaacattatttattgtaatatcttggcaaagaaacttgaaattaaa
agttaaagtactgagttctttttaaaatactaatctcctatctaacatgtagttatccat
aatcttttcttgcttttttaatcttacaaattatatattattagtagtattgttttattt
EXON 13  117 bp
attaacatccagtgaaatgatattgtctgcttatgttcagtagttgtggttacctagtta
ttatggaagtgtttccacatttttatgaacaatttaaaaagtcatatattatggagcaga
aaatattaattctgattacacagtatcctcgacattgatttctgtttttacctcctaaag
AACTGCACAGTGAATCCAAAAGAAAGTATACTGAAAAGAGTGAAGGATATAGGATACATC
TTTAAAGAGAAATTTGCTAAAGCTGTGGGACAGGGTTGTGTCGAAATTGGATCACAG
gtaacttgaattcattgtaattcgtggtactatagagtaataatattaaaagcagcatct
ttccagttcgtataaatactctaacagtatttgtctagtagtataaaatactgtcagata
ctatatccctgctgcctgtgtatgctgctatttatgggtaactttatggaaaactacctc
EXON 14  57 bp
gtggtacatgcctataatcccagcctcttgggaggccaaagcaggaggatctcttgagcc
caggagtgtgaaggccagcctgggcaaaacagtgagactccatctcaaaaaaaaaaaaaa
tttcataattgtgattttctaaaatagcaggctcttatttttctttttgtttgtttgtag
CGATACAAACTTGGAGTTCGCTTGTATTACCGAGTAATGGAATCCATGCTTAAATCA
gtaagttaaaaacaatataaaaaaatttcagccgggcgcggtggctcacgcctgcaatcc
cagcactttgggaggccgaggtgggcagatcaggaggtcaaggcatcaagatcatcctgg
ccaaaatggtgaaaccctgtctctactaaaagtacaaaaattagctgggcgtggtggtgt
EXON 15  32 bp
tcccttgaaccagggaggtggaggttgcagtgagccaagattgtgccatttcaccccagc
ctggcaacagagcaagacaccatctaaaaaaaaaaaaaaaaaaaaaaaaaattcaatgct
gacacaaataaggtttcaattaaacaacttctttttttttttttaaattatctgtttcag
GAAGAAGAACGATTATCCATTCAAAATTTTAG
gtaaattttttacttttagtaaaaaatttttttctttttatagaagtaagtattttataa
tctttttttttttcctttagcaaacttctgaatgacaacatttttcatatgtctttattg
gcgtgcgctcttgaggttgtaatggccacatatagcagtaagttaaattttcataaataa
EXON 16  81 bp
tcaatgctgacacaaataaggtttcaattaaacaacttctttttttttttttaaattatc
tgtttcaggaagaagaacgattatccattcaaaattttaggtaaattttttacttttagt
aaaaaatttttttctttttatagaagtaagtattttataatctttttttttttcctttag
CAAACTTCTGAATGACAACATTTTTCATATGTCTTTATTGGCGTGCGCTCTTGAGGTTGT
AATGGCCACATATAGCAGTAA
gttaaattttcataaataaacacttttgttcaatttaaagttaaaatgtggtgtgtttct
ttggtcgggggagagggatagtgtgaggttaaggagaaggaatgcttattttagatcact
atatactgaagaatgtaattggtcattataagccatttaagaggcttatttgagttattt
EXON 17  193 bp
tcaaaattggaaggctatttcctatgagtccgtagactccaaaataaaaaattctgctct
aaataaaaatggtttaacctttctactgttttctttgtctgataataacttccaaaaaaa
tacctagctcaagggttaatatttcataaatagttacttttttttttcatttttaggaag
TACATCTCAGAATCTTGATTCTGGAACAGATTTGTCTTTCCCATGGATTCTGAATGTGCT
TAATTTAAAAGCCTTTGATTTTTACAAAGTGATCGAAAGTTTTATCAAAGCAGAAGGCAA
CTTGACAAGAGAAATGATAAAACATTTAGAACGATGTGAACATCGAATCATGGAATCCCT
TGCATGGCTCTCA
gtaagtagctaaataattgaagaaattcattcatgtgcatatggctaacaaattattgtt
agtgagaggtgtttcttaacatctacctcaagaacatatagggaatttaatgaataatgt
tatttcagtctatagcccaaggatcaagtggaatattagaatggagctttaatcgagcac
EXON 18  119 bp
aaaaattgtcaattgggaatttcgaagtagagaaaaatatttcattctgacttttaaatt
gccactgtcaattgtgcctaaaattcatagtacttaccatgtcaaacaatatgattttga
tatgtacctgggaaaattatgcttactaatgtggttttaatttcatcatgtttcatatag
GATTCACCTTTATTTGATCTTATTAAACAATCAAAGGACCGAGAAGGACCAACTGATCAC
CTTGAATCTGCTTGTCCTCTTAATCTTCCTCTCCAGAATAATCACACTGCAGCAGATAT
gtaagcaaaatatatgttatgttgaccattcaaactgcaaatagattttaagcataagtg
caatgtaacattctataaagaaactgtagggaatagaattttgaataagaatagtttctg
tttttaagaaattagtaataaaaggtacatgacccaaataaagtcatataaaagagtaca
EXON 19  146 bp
gatatgatgatgacaagcagttttcctattaatatatctttcccagcttgcatttaaata
gtctgctataataccaattaaatagacaagatgtatctgggtgtacaaccttgaagtgta
tgtataatctgtgattcttagccaacttgaaatgaagacttttcctttaaatatatctag
GTATCTTTCTCCTGTAAGATCTCCAAAGAAAAAAGGTTCAACTACGCGTGTAAATTCTAC
TGCAAATGCAGAGACACAAGCAACCTCAGCCTTCCAGACCCAGAAGCCATTGAAATCTAC
CTCTCTTTCACTGTTTTATAAAAAAG
gttagtagatgattattttcaagagcatggactctgaaactaggctgactgggttcaaat
catgtttcttctactttctaggtacattactgggcaagtcacttaatatctctgtgtctc
agtttcctcatctataaaatggaaatgataatgttgcgagatctttcttgactattcaga
EXON 20  146 bp
tgcctcataataaaccagtaaacatgtttctctgggggaaagaaaagagtggtagaaaag
aggtttctgttaaaatgctacttaacagcattataattagagcgatttcatgatttgaaa
aaaatctacttgtaattcaaaatgaacagtaaaaatgactaatttttcttattcccacag
TGTATCGGCTAGCCTATCTCCGGCTAAATACACTTTGTGAACGCCTTCTGTCTGAGCACC
CAGAATTAGAACATATCATCTGGACCCTTTTCCAGCACACCCTGCAGAATGAGTATGAAC
TCATGAGAGACAGGCATTTGGACCAA
gtaagaaaatcaagcacttcaccttctctcctccctacttacttgttaactgattctttc
tttctttctttctttctttctttctttctttctttctttctttctttctttctttctttt
tctttctttctttctctctttctttcttttttttgagatagagtctcactctgttaccca
EXON 21  105 bp
tttaaacacactttgggttaaacacttcatgtagactttcaaactgagctcagtatggaa
agaaataactctgtagattaaacctttcttttttgaggctaaaagaaagaaaatggtatt
ttttaagaacaaaaccatgtaataaaattctgactacttttacatcaatttatttactag
ATTATGATGTGTTCCATGTATGGCATATGCAAAGTGAAGAATATAGACCTTAAATTCAAA
ATCATTGTAACAGCATACAAGGATCTTCCTCATGCTGTTCAGGAG
gtaggtaattttccatagtaagtttttttgataaatccatatccataacataacataggt
aattcatttgatctcatttattcattaatgagatcatatattctgtctgaccttattatg
taaattcacaaataaaaacttttatattatttatttgtaacttaaatagaattggaaaga
EXON 22  114 bp
aagcctaagaagtaattttatttatttattattttttcctttataatatgtgcttcttac
cagtcaaaaagtattataaactattagaaaagaaaatctaaaggtagaaattttaaaatt
catttaacaagtaaattttacttttttttttttttttttttttttactgttcttcctcag
ACATTCAAACGTGTTTTGATCAAAGAAGAGGAGTATGATTCTATTATAGTATTCTATAAC
TCGGTCTTCATGCAGAGACTGAAAACAAATATTTTGCAGTATGCTTCCACCAGG
gtaggtcaaaagtatcctttgattggaaaaatctaatgtaatgggtccaccaaaacatta
aataaataatctacttttttgtttttgctctagccccctaccttgtcaccaatacctcac
attcctcgaagcccttacaagtttcctagttcacccttacggattcctggagggaacatc
EXON 23  164 bp
gaggagtatgattctattatagtattctataactcggtcttcatgcagagactgaaaaca
aatattttgcagtatgcttccaccagggtaggtcaaaagtatcctttgattggaaaaatc
taatgtaatgggtccaccaaaacattaaataaataatctacttttttgtttttgctctag
CCCCCTACCTTGTCACCAATACCTCACATTCCTCGAAGCCCTTACAAGTTTCCTAGTTCA
CCCTTACGGATTCCTGGAGGGAACATCTATATTTCACCCCTGAAGAGTCCATATAAAATT
TCAGAAGGTCTGCCAACACCAACAAAAATGACTCCAAGATCAAG
gtgtgtgttttctctttagggaagtagtaaagaatgagagggggattattttgatccaag
aataaaaaatataaagcattcttcatttcaaataagctagactcttgaaactctatttgc
ttatttaagtaacataataagaatatgggggcggggtgaagaaaatctatttacgactta
EXON 24  31 bp
atgattagacgggcactgttagaataattcccaaatgaatatagtttgtcagtggttcta
gggtagaggtaacctttaatttggtattcctaatagttcagaatgatgtatttatgctca
tctctgcaaaattgtatatggttttttattactaattggtatttcatcttaacttgacag
AATCTTAGTATCAATTGGTGAATCATTCGGG
gtgagtattttctttctatgaaatataatagtatgcattgtaagtataaaagaaattaaa
gctttctataatttgaatttccaaatgcagttattcaaacacctcatccaggcatattgc
atagaattttatgagatatatatatctcagatttactttcaaatcaagtttaatctcaaa
EXON 25  143 bp
aggtagttattctgatttttagatttttcatatcttttatttggtccaatgaagcagaaa
atttaaatgaagttattacctttgcctgatttttgacacacctcaaactataacttgagg
ttgctaactatgaaacactggcatttaatgatttaaagtaaagaattctgtaatttgtag
ACTTCTGAGAAGTTCCAGAAAATAAATCAGATGGTATGTAACAGCGACCGTGTGCTCAAA
AGAAGTGCTGAAGGAAGCAACCCTCCTAAACCACTGAAAAAACTACGCTTTGATATTGAA
GGATCAGATGAAGCAGATGGAAG
gtaggaaccagttttgaatgttttccagtagccgagatggtcatctggggaatccagagt
ctcagcactgctcctggcttataccaatttctttcatgccaagtttatttggaagttgtg
agaatggctcaaaataatagatatgagtgtagtgcaaagttaaaaacatcttacaaattg
EXON 26  50 bp
atagcatcataaatttgtgacatttatgttttagatggttagtttttaaattttaaaatt
aaaagctactcactaaaataatagcataaagtaagtcatcgaaagcatcatagttactgg
aaatttgagttttccatttataaatacacatgaaatgttttgcatttttttaatctgcag
TAAACATCTCCCAGGAGAGTCCAAATTTCAGCAGAAACTGGCAGAAATGA
gtaagtacttttttcaccttgtgtaaatgaaataaacaattgtttacactgcaagaagtc
ttttcgttatataaaagaatgtataatttcttcagttggcaggtttgtttatgcatttaa
aatataattcaatcaaggttatttatctacaaacatttgtggattaaatgtatgatgtaa
EXON 27  1889 bp
gaaatatgcagtaaattaactgtaactccctacggtactgtcaaatactagaatgaagac
cactgcttttgcaaggtcctgagcgccatcagtttgacatgagcataatatatatggcag
ccacttgccaacttacccagtaccatcaatgctgttaacagttcttcatcctttttccag
CTTCTACTCGAACACGAATGCAAAAGCAGAAAATGAATGATAGCATGGATACCTCAAACA
AGGAAGAGAAATGAGGATCTCAGGACCTTGGTGGACACTGTGTACACCTCTGGATTCATT
GTCTCTCACAGATGTGACTGTATAACTTTCCCAGGTTCTGTTTATGGCCACATTTAATAT
CTTCAGCTCTTTTTGTGGATATAAAATGTGCAGATGCAATTGTTTGGGTGATTCCTAAGC
CACTTGAAATGTTAGTCATTGTTATTTATACAAGATTGAAAATCTTGTGTAAATCCTGCC
ATTTAAAAAGTTGTAGCAGATTGTTTCCTCTTCCAAAGTAAAATTGCTGTGCTTTATGGA
TAGTAAGAATGGCCCTAGAGTGGGAGTCCTGATAACCCAGGCCTGTCTGACTACTTTGCC
TTCTTTTGTAGCATATAGGTGATGTTTGCTCTTGTTTTTATTAATTTATATGTATATTTT
TTTAATTTAACATGAACACCCTTAGAAAATGTGTCCTATCTATCTTCCAAATGCAATTTG
ATTGACTGCCCATTCACCAAAATTATCCTGAACTCTTCTGCAAAAATGGATATTATTAGA
AATTAGAAAAAAATTACTAATTTTACACATTAGATTTTATTTTACTATTGGAATCTGATA
TACTGTGTGCTTGTTTTATAAAATTTTGCTTTTAATTAAATAAAAGCTGGAAGCAAAGTA
TAACCATATGATACTATCATACTACTGAAACAGATTTCATACCTCAGAATGTAAAAGAAC
TTACTGATTATTTTCTTCATCCAACTTATGTTTTTAAATGAGGATTATTGATAGTACTCT
TGGTTTTTATACCATTCAGATCACTGAATTTATAAAGTACCCATCTAGTACTTGAAAAAG
TAAAGTGTTCTGCCAGATCTTAGGTATAGAGGACCCTAACACAGTATATCCCAAGTGCAC
TTTCTAATGTTTCTGGGTCCTGAAGAATTAAGATACAAATTAATTTTACTCCATAAACAG
ACTGTTAATTATAGGAGCCTTAATTTTTTTTTCATAGAGATTTGTCTAATTGCATCTCAA
AATTATTCTGCCCTCCTTAATTTGGGAAGGTTTGTGTTTTCTCTGGAATGGTACATGTCT
TCCATGTATCTTTTGAACTGGCAATTGTCTATTTATCTTTTATTTTTTTAAGTCAGTATG
GTCTAACACTGGCATGTTCAAAGCCACATTATTTCTAGTCCAAAATTACAAGTAATCAAG
GGTCATTATGGGTTAGGCATTAATGTTTCTATCTGATTTTGTGCAAAAGCTTCAAATTAA
AACAGCTGCATTAGAAAAAGAGGCGCTTCTCCCCTCCCCTACACCTAAAGGTGTATTTAA
ACTATCTTGTGTGATTAACTTATTTAGAGATGCTGTAACTTAAAATAGGGGATATTTAAG
GTAGCTTCAGCTAGCTTTTAGGAAAATCACTTTGTCTAACTCAGAATTATTTTTAAAAAG
AAATCTGGTCTTGTTAGAAAACAAAATTTTATTTTGTGCTCATTTAAGTTTCAAACTTAC
TATTTTGACAGTTATTTTGATAACAATGACACTAGAAAACTTGACTCCATTTCATCATTG
TTTCTGCATGAATATCATACAAATCAGTTAGTTTTTAGGTCAAGGGCTTACTATTTCTGG
GTCTTTTGCTACTAAGTTCACATTAGAATTAGTGCCAGAATTTTAGGAACTTCAGAGATC
GTGTATTGAGATTTCTTAAATAATGCTTCAGATATTATTGCTTTATTGCTTTTTTGTATT
GGTTAAAACTGTACATTTAAAATTGCTATGTTACTATTTTCTACAATTAATAGTTTGTCT
ATTTTAAAATAAATTAGTTGTTAAGAGTC
ttaatggtctgatgttgtgttctttgtattaagtacactaatgttctcttttctgtctag
gagaagatagatagaagataactctcctagtatctcatccattcctagcctttaaggggc
tctatatgctagagatttccaaatttatttcttcagccctgatcttttcacagaggtcaa