Gene RASA3 Variant 1
DNA : 149.27 KbNT_024498
mRNA : 2569 bp NM_007368
CDS : 2505 bp NP_031394
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  101 bp
ctgccaaccccgcccctgcagggcccgggccagttgggagcaggggccgggccgcgggcg
gagcctcccggtccccgccctcgccctcggccaactggcggtcttgcaggcgggcggacc
ctcggccgcgctcggggctccggcgccgccgctcctcctgctcggcctgagctgcccggg
CTCGGCGCGCGCTTGGGGCGAGGCTCGGCGGGCGCGGACGCGCAGCATGGCGGTGGAGGA
CGAGGGGCTCCGGGTCTTCCAGAGCGTGAAGATCAAGATCG
gtgagtgtccgccggcagccacgcgtccgaccccccggcccgaccctgtcctctcccgcg
cccgcctcccctccgcagatccttgctggggaccccggcggagacgccctccaggcgcgg
cgcgctccccggagaacggctggtccggctccgcggcccctccccacctccccgcctccc
EXON 2  118 bp
tcgcctttcggcagtacacatggggtgcacatccacattttgacttgtggtggcaaaaaa
accaaggctttatagagagctagtgaatgcacacaagcaaaggctggaaacgtgtctgcg
atgtagcagggaacaaacatttctacgctgctgatgatgtatgtcgcttttactttttag
GTGAAGCCAAAAACCTTCCCTCTTACCCGGGGCCGAGCAAGATGAGGGATTGCTACTGCA
CGGTGAACCTGGACCAGGAGGAGGTTTTCAGGACCAAAATTGTGGAAAAGTCACTCTG
gtaatgtcttctgttgctttacttggcactgatgtgttttctttggtgtagagaatgtcc
caagggtgtacgtcaccttcccattttcccatgtgtggagaacgtcccgagcgtgtacgt
caccatcccgttttcccgcatgtagggaatttttctgtgcgtagacaatgtcccgagcgt
EXON 3  104 bp
ccggggagcagctacgaggcccttcaccccacagggagctgcaggttcatgtctcatgcg
tgccacacagtgcagggcattcttatggcatgtttaaaactaagaccacacgtgtgtgcc
ccgggggtgaggcgcaagcgtggcctgtgttctaactggcgcttttctttgtctcactag
CCCGTTTTACGGAGAAGACTTTTACTGTGAAATTCCTCGGAGCTTTCGTCACCTGTCCTT
CTACATTTTCGATAGAGACGTTTTCCGGAGGGATTCCATCATAG
gtaggtgatgaatgagcatttacttccccttttctgcctgttctgtaccaggcgagtatt
agcatttcagtccagagcctggctggatggtgctgaggggtcgctgcagggcttgaggtc
acagcagccctgggtgttcctcctgatctgctcttgggatctggcctggcatctgtggtc
EXON 4  95 bp
ctcccccctgggcctcccaagcgtgggggttccaggcatgagccccgcacccggccggtg
ccccattctgaattaaactgttggaaataagctgcggtgatgatgggctggcttctgctc
acaggcgtcctggctctggggcctgtgcccgtggtgaagtcttctctgcttgtgttgcag
GGAAGGTGGCCATCCAGAAGGAGGACTTGCAGAAGTACCACAACAGGGACACCTGGTTCC
AGCTGCAGCACGTGGACGCTGACTCGGAAGTGCAG
gtgagactctcggcgcagccccggaaaccagagccctgggacaccatggggcttcgagac
gggcccggctccgactgtggctaaagacgtagatcgggcttcggccttgactgggaataa
cgatgagcagattgcgtgttcgcccacttgtgctcggagtgagcgcgggctccgccatgg
EXON 5  77 bp
aggccacagctgggaccctgcgtcccgggggtggagtggaggggctggacgtgcccattg
gccagggcagggcggggccgcctgctccctttgccctctaggctttccctgggcgcgcgg
ccctagtggcctgtgggagcagcgccacagcctctgacaccccatccttgtgccttgcag
GGCAAAGTGCACCTGGAGCTGCGGCTGAGCGAGGTCATCACAGACACTGGGGTCGTCTGC
CACAAGCTCGCCACACG
gtaagacacgtcctcactagagaccgagcgcacagcgagtggcatgtctggctcccgagg
agcacacaggggttttcacaccaacgcacaagaatttccagagccggtggctgcccagga
tgacactgtttagaggtcctggcccaccaggatgatgctgttttaggggtcctggcccac
EXON 6  81 bp
tggccagcgtgattcagcgtcacaccgaggcagaatggctggtgtggccctccctgcctt
ccggtgaggaaacctcatctcacagcttgaactcaggcctcctgcctgacccagagctgt
ctcgccattcgcccaggtgtctgcgctccctcctgacgccgcctctgcttctctcctcag
CATCGTCGAGTGCCAGGGCCTCCCCATCGTGAATGGGCAATGTGACCCCTACGCCACCGT
GACGCTGGCAGGACCCTTCAG
gcaagttgcctcacgcttcaggtttctgttctggtcctggggggctagggtccagctctg
aaatcacgagaccactgcctcatttgggaggagtcaggaggttgcgctttgaggtagaat
gtgaatttttacttccttttgttttctttattgctccaaaattgctttgtagaaaatgaa
EXON 7  73 bp
tttttggctgagtaaaggttcctgatttgcataccatctggagttggagaccagcagaaa
tatttataaaataaataaagccaataagtgacttgtgcatttgagagctcggttttacca
ctgagagacttggaatcagcagtgttgttttaatcccaatcctttctcacttgataacag
ATCAGAAGCAAAGAAGACGAAAGTGAAGAGGAAGACCAACAATCCCCAGTTCGATGAAGT
GTTTTATTTTGAG
gttggtatcttcatgggtcaacgttaagtggaaactctgcacccgagacacgttggcaga
aagtctggatccagaatgatctcagtctcttccctctggaagttccttccggagaggagc
gagccccgccagccggccctgggttccttccggagaggagcgagccccgccggccggccc
EXON 8  77 bp
aatgctggcactcaggaagccaggcctgaatcccgaatcccgcctggcgccttcctggtt
gtggcccttgagtggtgtgtgggtaagcgcagagggtagggcagcccggggcctaggtcc
gcatatacccccgcctggtggcaccgcggtctcagcgctttctctctcgtctgactccag
GTGACCCGGCCCTGTAGCTACAGCAAGAAGTCCCACTTTGACTTTGAGGAGGAAGACGTG
GACAAGCTCGAAATCAG
gtgagaaaaccaggctccgcgtccccaacttggcagttttcacccaaactcctcagctct
tttgttctttgttactaaatatagggtcatagatagaaatgaatttccattttcttggta
attttcacaacaggatgttagaagttgtagttgaagtgacagcctgtgggtggtgttagg
EXON 9  105 bp
ccaaagccacaggctggtctgacgtgtttgaaacgtgccctgtgggctgagccttgatgg
agactctgggaggcgctgcaggctccattctgctcctgggggaacaaagcgtggcctgtc
atctttgctccacacgggctgcccgccgtcagctagagctgtcctgatgctgtttttcag
AGTTGACCTCTGGAATGCCAGTAACCTGAAGTTTGGAGATGAATTCCTGGGAGAACTAAG
GATCCCGTTGAAAGTCCTGCGGCAGTCCAGCTCCTACGAGGCGTG
gtaagatgatgttgcacctgcagacttccgcatctctgagagccacaaaaacacgtgctg
cctctgagtggaaaggcacagaggccacatgtgctggtcctcggctgtgcccagcaccca
cctgctcttactttgcatgtagctctgacgagctctggcttgatgagtttctgccccaca
EXON 10  157 bp
cccggtgaccagccctgctgggggtcttcggtggggagtccccaggggctgcactctgag
gggtcctacaggatcaccctcctgaccagtcgacctcaagcaggcagctgggcttccctg
agagctgctccttggcagatgcagcctcatgcctcccctccatgtgtccctcccacccag
GTACTTCCTCCAGCCCCGGGACAATGGTAGCAAGAGCCTAAAGCCAGACGACCTGGGCTC
CCTGCGGCTGAACGTGGTATACACGGAAGACCACGTGTTTTCTTCTGACTATTACAGCCC
TCTGCGGGACCTGCTGTTGAAGTCTGCGGATGTGGAG
gtgcttgtccacgccgtggcctgtgggtgtgggcaggaggtgccacctgcctggggcccc
accctacacccgggcccaccccagagggcaccttctccctgagggggcctttcccacgcc
tcccagcctggcctgtttcccgtccagatgcctggacccctttgctgggggcactggtcc
EXON 11  149 bp
caagggtccagccaagcagcagcaaatgggaagtttggtgtttttgtgaatgtgtgtgtt
tctgtctcagcaaagagccgtatctattgtggctggaagtgagaccccagccaaggtggg
gacaggcctctggggttcctgcaccccgggccctggcactgacctcacccctccccgcag
CCCGTGTCAGCGTCTGCGGCCCACATCCTGGGCGAGGTTTGCCGGGAGAAGCAGGAGGCG
GCCGTCCCGCTGGTGCGGCTCTTCCTACACTATGGCAGGGTGGTGCCATTCATCAGTGCC
ATCGCCAGCGCGGAGGTGAAGCGGACCCA
gtgagtgcccaccctgccccgggggagagcggcctggacccgctacagggatggcaaggt
cgtcgccgagaaccacgtgtcctggggcagggcttgagggaattcaagggtccccagaaa
ccatgttgattcaggttttctttcacagacccagttaatgattcttttttttttttttga
EXON 12  115 bp
tccatggccagggcctccaagcacctggcctggttgtgctccttgtaaaatgtcaggaag
ccgactgatgggcgtgcactgacctcacagcccacaggcaggtgctcggggccaggctct
gctccgtctgcacttccgcgtccccaggagacaaacgctgtccccatcgccatttcccag
GGACCCCAACACCATCTTCCGAGGAAACTCACTGGCGTCCAAGTGCATCGACGAGACCAT
GAAGCTGGCGGGGATGCATTACCTGCATGTCACCCTGAAGCCCGCCATCGAGGAG
gtgagcacggggccgagagtcctcagcctcacgaggcgtggggaggatttcccccaacag
agggcactgcactgggatccagccagaccacgagctgggcttgaatgtcggcccctctgg
cctcgccacggggatgctgattcattcacttttatcaagaggatgttccctgtgtactcc
EXON 13  75 bp
gccctgcagtccggcctcaccgtgcccctccgtgccagtggccgggttcggggagctgtc
gtggcattttctggatgaggctcagggtctacatctcagccaggcctgagaccccttcca
ccctccctgcctgtgcccccagaacccactcacagagccctgtcttaaacctctccccag
ATATGCCAGAGCCACAAACCCTGTGAAATCGACCCTGTGAAGTTGAAAGACGGAGAAAAC
CTTGAAAACAACATG
gtaggttttgttcatgaaccaaccaaagccagtcacctgcttggggtttttcagccgatg
gctgcctggaagctctgactcaccccgtgaccccggttggggtgggagcaggaccaggcg
tggggatacccgcctcacccggctgcagtacgctggctgcactactgggaggcctcagcc
EXON 14  124 bp
attgccacagctcccagcacagatttccagggagtggctgttcacacgtgtctcactgcc
gcagctgccctgcgcccgccctcagcccctccccacgcgcccctccctgggcgtgccctg
gtgctacacgcacctgtgggcagcctcgggagtgggtcccagtgccgtgtcccgttgcag
GAGAACCTACGGCAGTATGTGGACCGCGTCTTCCACGCCATCACTGAGTCTGGGGTGAGC
TGCCCGACCGTCATGTGTGACATCTTCTTCTCCCTCCGGGAGGCGGCGGCCAAGCGCTTC
CAGG
gtgagtgccctgaacaccctcatgttgctgagaaactgccatagcgctgtgcagggtgac
tcccacccaggcagaaccccccgcagccctggctagactagaactgcggggtcgtgaacc
ccagttccgatgctggatttttccggggtttgtgcccgggccagtgttccctagttcaca
EXON 15  107 bp
agagggaaacagagagagggagagagggaaacagagagagggagagagacagacacaggt
ggagatagagccaggactgtggctggacttccctgcggaccctcagggggccggggcatg
gtgtccccacgaggccattgtgcccgaggaaaacggtcaccctgcttctctctcccgcag
ATGACCCGGACGTCAGGTACACTGCAGTGAGCAGCTTCATCTTCCTGAGGTTCTTTGCGC
CCGCCATTCTCTCCCCCAACCTCTTCCAGCTCACGCCGCACCACACG
gtgagtgaccggctgagggaccgaggctttctgagctgtcctgcgacgccggcctgggtt
ggggcatctgcgtggctgtagggggccgaccgtgtggagtgtggaatgcgtggggagtgt
gtgaggaatcaggagtgagtggggagtgtgtgtggaatgaggagtgagtggggagtgtgt
EXON 16  78 bp
tgagactgtgggacgcccaccccctccagtcccatctgcgtcgctacccctgtttctccg
tagctcatgcacaagccacagcagctctgaggtgactcctgcatttcgtcccctcgatct
gggacagtcacagcatttctgtgatgctgacatagacctttcttgctcccgcctccccag
GACCCCCAGACGTCCAGGACGCTGACATTGATCTCCAAGACCGTTCAGACCCTCGGCAGC
CTGTCCAAGTCCAAATCT
gtgagtccctcttcttcattttctctttttagggacaactgattcttttctctcttcaga
aaatacacgtgaaaaacctcccacatttgagagagtcgtaagataaagatcaagaatcaa
agccggcaccacatcctctcttgaaacccaggacctgagcgtccccgtcccgctcacctc
EXON 17  78 bp
cgatttatgtgattcgtcctccgggcagccctgcgggctctcacttgcccggtaacaccg
ggttctttgcctgtttatcgtcatttaggcttggacagttcttgcctctagctttttcag
atttgggccgtgagccgaggtacttcgggctgtcctcgagtgatctccgtttcattttag
GCGAGTTTTAAGGAGTCCTACATGGCTACATTTTATGAATTCTTCAATGAGCAGAAATAT
GCTGATGCGGTGAAGAAC
gtaagtatcgactcaccctccgaccgcccgtgtgccgtgctcaggagacggagttctctt
ttaaaattgagatagaacccacatgacacagacttggccattagcgattttaaacaataa
aggcgttcggtgcattcacagcgctgtccagacagccttgtcccaagtcctgggacacct
EXON 18  74 bp
tggggtggcacagtggggagcagaggccccacagccctcggggaaggactcacttgccca
gattctgtctccactggtattacaaaggaggcagtagccgccgacgctgttgttatacag
agagccgtgcacgtcagatgtgtggcttcctcccggtgacctgatttcttccaactttag
TTCTTGGATCTGATTTCGTCCTCGGGGAGAAGAGACCCCAAGAGTGTTGAGCAGCCCATC
GTGCTTAAAGAAGG
gtaaggagggtaaggtggcgtctggcagggcaggaggggagaagggtaaggtggtgtcca
gcagggcaggaggggagaagggtaaggtggtgtccggcagggcaggaggggagaagggta
aggtggcgtccagcagggcaggaggggagaagggtaaggtggcgtccggcagggcaggag
EXON 19  107 bp
tttcaaaggagaggcattgccttccaattttaatctcatcactcggagtaaaatgataag
atattgaaaatccactgcctgcctcaggtctcagaacgcagaaagtggggggtgtggttt
ttcacctgtgcagggaggcagctgaggcccggaccccggccctgtgtgctcttcacacag
GTTCATGATCAAGAGGGCCCAAGGACGGAAGCGCTTTGGGATGAAGAATTTTAAGAAGAG
ATGGTTTCGCTTGACCAACCATGAATTTACCTACCACAAAAGCAAAG
gtaaggagcaaggtcgctttccctggctcttgctggagcgtgctgggccctgggactgag
tctgctttttcagggggagagctgaggggaggaaggattcagtgctgcgggcagagcccg
gggccgcggtgacccagagccctctgcttctggttctcccttcaaagatccctgaagggg
EXON 20  83 bp
ccccggtagagaccccctggcagagaccccctggcagagaccccccggtagagaccccct
ggcagagaccccccggtaaagaccccctgggagaccccccggcagagacccctcagcccc
acccggaccccagccgggacagcggggcccgcacccactgacagtccatctctgctgcag
GGGACCAGCCTCTCTACAGCATTCCCATCGAGAACATCCTGGCAGTGGAGAAGCTGGAGG
AGGAGTCTTTCAAAATGAAAAAC
gtgagtgtggggcccccaagcctctctttcgggttgaggcctggccaggttttctctgct
ctcttcccgtacctggccctgggctcacccttccccacccactgcactccaggcttctca
gagtcttcgtgttactcgggttgttcaccaggtgctggtgagtttgtgtcggaatctcgc
EXON 21  209 bp
ccatgcaccccctggccttggcctcttctggggcttagagctccaggacttttgggcctg
tgcaccctcagcgtcccctcttacgactccggcgaggacggccaggtgcctggtggactc
ttgcacgtgctcagccacgagacctcatgtgcgctgtcctgagcccacctgtgtcctcag
ATGTTCCAGGTCATCCAGCCAGAGCGTGCGCTGTACATCCAGGCCAACAACTGCGTGGAG
GCCAAGGACTGGATCGACATTCTCACCAAAGTGAGCCAGTGCAACCAGAAGCGCCTCACC
GTCTACCACCCGTCCGCCTACCTGAGCGGCCACTGGCTGTGCTGTAGGGCGCCATCCGAC
TCGGCTCCGGGCTGCTCGCCCTGCACTGG
gtaggtctgtgcctcggtgcccagctcgtgcactgtgcaggaaatgtggccaaggggctg
agtagggagggaccagcagacagtgcatgcctgcctgtaagctgcacataaacagggctg
ccctcgcctcctcccaggagcctcccacccgaggggtcctccctcgagggagcatctggg
EXON 22  104 bp
ccttgctcagcaagccaacacaccggctgtgcacagacggacagcaaatcgatcctgtcg
aatttcacttccaacacaatcgttgtctttcttcagtgacattttaaaaatgaatgtcat
tattaaaagcatcgtttaaataagtgtttttatctttctgttcttgctgtgtctggacag
CGGCCTCCCAGCCAACATCCAGCTGGACATTGATGGGGACCGTGAGACGGAGCGTATCTA
CTCCCTCTTCAACTTGTACATGAGCAAGCTGGAGAAGATGCAGG
gtgagtctgcccggcacacagatctgtgcagcgaggggatggctggcgaggccccggcct
caggagcatgctgtggggtgaaaacctgtggtctgagcctctggtgtagtgtgggctaca
tgtagttgtctttgtagcacggatggatgcgaaaagctttttgcagggtaggcagctatc
EXON 23  184 bp
cctacctgcgggaatggtttctatctccgtctgcgtttacgagtggtggtcagccctttc
tggaggagcttgcgttggaaggatgtgtactgtgggtggggcctgcagcgacgcagctgt
gtggagacggggccggtggcctgggctcctgccctgcgctgacccctccgccctccacag
AGGCCTGTGGGAGCAAATCTGTGTATGACGGCCCGGAGCAGGAGGAGTATTCGACGTTCG
TCATTGACGACCCCCAGGAGACCTACAAGACGCTAAAGCAAGTCATCGCTGGGGTTGGGG
CTTTGGAGCAGGAGCACGCCCAGTATAAGAGGGACAAGTTCAAGAAGACGAAATATGGAA
GCCA
gtgagtgccactcccgtgcctgccctggacggccagtgtagtgggcgggagattgcagtg
ggggtggggctgcagggagctcccgggtggggccgcccgtgctcaggtgtccgcctggga
ggagagtcccacttgcaccgggctggcacctggcggtagtcagtggacgtggcccggcgc
EXON 24  94 bp
acacatcagagtcaccgtgggtgcttccgggggcactgtggttcctttggctcctctatt
ttttgtgtggattgcagtgtgagtgtgtcacatttaggaacaggaaaagctcccgcagcc
acgggtgagcaccaggcaacggggtctgtgcctcattccctctcccatcccccttttcag
GGAGCACCCCATCGGAGACAAGAGCTTCCAGAACTACATCCGGCAGCAGTCCGAGACCTC
CACTCATTCCATTTAAAGTCTGCGGGACGCGCCC
agtggcgccagcaagctgcccatgcaaagccgcagcctttgggagggagaagagaaggaa
gagcgcagagccggcaaagtgagatgcacgccgtcccggcccatagacaagtggcgctgg
ggtttccctctcccagaaccgctgccaccaccgccacgccctccgcagaaagcccacctg