Gene RAP2A Variant 1
DNA : 33.77 KbNT_009952
mRNA : 4349 bp NM_021033
CDS : 552 bp NP_066361
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  563 bp
accccgcccctggccgcgctgcggctggggctcgggcgcgcgctcgagcgctgggggtag
cggcggcggcggcggcggcggcgggcggggatctgggcgtggaggcgcgaggggcggggc
gggcggcactgcgggcccgcggctcgggcggcaccagcggctcccggtctctctctctgc
TCGCCCTCAGTCCCACCCGGTGCCTACGGGGCCGCATCGCCGCCCGGCTCGGCCCGGCCC
ATGCCCAGGGCCGCTGCTCCCTCAGTTGCCGCCGCCGCCGCCGGCGCCCAGGGGGCCGCC
GCGGCTGTGAGGTGGGGGCGGCAGCGGGAGGCGGCGGGGCGGGCCGCCGGGGCCGGGGCT
GGGGGCGCAGCGCGGCCGGCGTAGGTCTATGTCGCGGGCGGCGGCGGCGGCGGCGGCCGC
GGAGGGACGATGCGCGAGTACAAAGTGGTGGTGCTGGGCTCGGGCGGGGTAGGCAAATCC
GCCCTGACCGTGCAGTTCGTGACCGGCACCTTCATCGAGAAATACGACCCCACCATCGAG
GACTTCTACCGCAAGGAGATCGAGGTGGATTCGTCGCCGTCGGTGCTGGAGATCCTGGAC
ACGGCGGGCACCGAGCAGTTCGCGTCCATGCGGGACCTGTACATCAAGAACGGCCAGGGC
TTCATCCTCGTCTACAGCCTCGTCAACCAGCAGAGCTTCCAGGACATCAAGCCCATGCGG
GACCAGATCATCCGCGTGAAGCG
gtgagcgagggcacacgggggcttggcggctgcaccccggagtcaccgtcccggggctgg
aactccccgcgcggggctccggggaaggggctttctggggggtggctccaagctggaggc
tttactattgtcattctgctcctcctcctcaatctcaaatttgagtgctttgtttcacaa
EXON 2  3786 bp
tgtgagagcagcttcaaatgccctcagatctaagtatcaagccaagtggtacaaatcatt
ttcatgcaactgaagataccatttatgttggaatagcccccaaaaacgaaaatacacgtg
acctgtttaactttgtgctaactgttacaatgtatgtgtgttttgtttattctctcatag
GTATGAGAAAGTGCCAGTCATCTTGGTTGGGAACAAAGTGGACCTGGAAAGTGAGAGAGA
AGTATCGTCCAGCGAAGGCAGAGCCCTTGCTGAAGAGTGGGGCTGCCCCTTTATGGAAAC
TTCCGCTAAGAGTAAAACAATGGTGGACGAACTCTTTGCAGAAATTGTGAGGCAGATGAA
CTATGCTGCTCAGCCTGACAAAGATGACCCATGCTGTTCTGCATGTAACATACAATAGCA
TCCAAATATGGCTGTCCTGGATGGGATTTGCCCAATGTCGTAGGTGATAGAAAACTCGCC
TACTCCACTGCAGAACTTGCAGAATGCGTGGTGTTAATCTACAGAGAACTGCAGCCCTTA
TTCAGAATTGAGCAGTGATTGTCAGTTGATATCTCTGAGTAACATTTGGGTTCAGTAACT
ACAGTTTTCACCATTTGTCCTCAGTCTCCTTTATGCATCTGCAACTTTAAGGCATAGTCC
ATCGATCTACAGGGTGATCTCATTTGAAAGCTATGATGGCATTGTCGCTGAGTTGACAGA
AGCAACTATTGTACAAATTAAAAATAACCATAAGGGAGAAACCAGAAGAATTCCTCTGAC
CACTTACAATTAAAATATTTTGTCTTCTTTAAAAAAATAAGTAAAGGAGAAATATTTTCC
TACAAGAGTACTGAATTTCAGGAAATGGGATAGAGCTTCTAACCAATGTATTCCGTCAAG
TAAGATAATAACAGCTGACCTGCCAACAGCATTACAGGGAGATTCTTTGCTCAGCTAACA
CATTTCTGTTTTTCAAAATTGATGCTTAATTGTAGCTGTTATTCTAATTTGTGACATGGA
ACTAACTCATGCTTCAATCCTTGATAGAGCAAAACTCAGAACAGGTTATGTAAAAATATA
GTCTGGCTTTAGAATTTGTTAATTCACCTGCTTTGCCACAGAAAATGGAGGCTTTCACAA
GGGTTTGATCAGAATTAAAACCCCAAACCCGCCCTCTGTTAGGGGTGGTCTTTATAACTT
TACTGAACAAGAGGGAAGCAACTGTGATGGGAAGAGATTACCTAGCCTTACTAACAAGAA
GCATTCTAATAGATAAACTAGTACCATCATGTAAGGAAGATGAAGCCATGTTGCATCCAC
ATGTTCCCGTTTGCAGAAACCTCACAGGACAGTACGAATATCTGGCATTTTTAAGTTCAT
TAAAGCAGCAAATTCCTTCTCGCCTTTAAGGGCTATGGTTGTAGTGTGACCCGTGGCTAA
CCTGCTTTCAAAATCAAGTATTTGCTGTAGCAGAGCTTTATTGCAGGCATTTTAAAAATT
GAATAACCATGTGAAATAATTTGGGCTTAAAAGTGAACATAAATTATAGAGTGGAAGGTA
AGGGACAAAAGCCTTTTACCTTTAATTTTCCTGGAGAATTATATAAAGGTTTTCTTAGAA
CAATTTTGCCCTGATTACTGAAGCGTCAAATAAAGCTGGAGTGAAAATTTTGTTTTGAAA
AGGTGCTCAAGCTCTGACATTTTTGGTTTTCATAGTCGTGAAGTATTTATCATTTGCATG
ACTAATGGCACAGGAAAAACCTATTCATAAGTTTTACAATCAAGTATAGAGGGGTCTTCA
GCTAACTTAGTTATACATAAATGCTGAAAAGATTATCTTGAGCTGGGCCTTGGGAGAAGA
ATTTGGCCTTCAGAACTGCAATATCACTGAGCCTGCGATCTATACACCACCCCACATTTT
GTTGGTTTCACAGTCTTGTGCAAGTAACCTCTGGTCTTACGTGTGTAACTGAGAGAAGAG
TGTGTGTTTGTGTGTGCATGTGTGTTTATTGTTCCTAAGAATTTGGCACAAGTCAGAGAT
AATTGCCTATACTAAGAATCTATACTGCAGAATATAGTGTATCAAAAACTTTTTTCTTTT
AAATTATTAAAGTGTCTTTTATACTTTTATGAAATCATTGGTAGCCCCCCAAGTGTTTAA
TAACTGGCATTAAGCTTAGAGGGTGAAAAAAAAAAAAAAGATTGATAGTATTTTTCATAA
TGAAAAAACTGAAGAGATACGTGAATGAAACCAGGCCATAGCTGTCATAAATCTTTGACT
TTTGAATATTTACATTCTTCAGTATAATTTTTTATAATCCTCAATTATGAACCACCTTGT
TTATAGGACAAAAAAATTTAACCAATTTTATTGAAACGAATTTCACTGTGTAAAAGTTGG
TTTGATTCAAACATGTAGAGAAGTTGTAGATTCAAGATATATGATTTCTCTATGGAAATA
AAAATATTTGTTAGTGAATTGGTTGAGTTTTGATTCCTCTAACTTCTCAGAATGATTCTT
TAGAATTCTATAATTCATAGCAATTTTTGACAAGTAAGATTGCAAAATAGAAATATCTAT
AAAGATTCCACAGTTTGACATTATGGCTTGCTATGCAGATGTGAAAATAGGTTAAATAAT
ATGAAAGATATGGCAGAATGTAAAGTGGAAAAGATGACCTAAAATTTTGAGTTGTATTAA
TAGTTAAAAACATTTGTGTCAGATGACAGGGTGGGCTTTTACTGTCAAGACATGAATAAG
AACTGATCTGGCTGCCTGATGAGTGTTTCCACGCAGCCCTGCATATTTAGTGACCAAGGC
ATCAAGGACATCCCGAAACTGGAAATTCATATCCATCTGGTATGAATATATAACTCAGCT
GGCAAATGAATGTGTTTGTTGAGATATTACAGTAATAAAACACTTAAGAACAGGAAGATT
ACATTTGTTGGCATACGAAACCTTAGTGGCTACAGAAGAAAGTTGACCTTGTGTCACTAT
TTATTTTATGCCCTGATCAGACTAGCAACTTAGATAAGTGAAAGTTTTTCTAACATGCCT
TAAAAATATTATGGTTTGATCCAAAGACCCACTTTTTCTTTAGCTCTTGTGATAAGATTT
TCTTTTTTTTACTTTTATACAAAGGCAGCATCTTTGAATTTTTTTTTCTTTTGATGTTGC
AACTTTTGGGTTCTTTTAAACTGTGATAGTGATGGTAACTGATGCCTTTCATTTTGTTCA
ACTTATACAAAACAAGCCAGCATCTGATCAAAAGTATTACATAAAATATTTTCTTAAACT
ATTGAAAGGTGCTTTGATGATTTTCTCCTTTGGTTTGTAGAATTAGGACTGAACTTTTGA
CTCAAATTGCTACAGTTGCCATCACCTTTCTGTGGTAATACTACTGATATTTGCTTTTCT
ATATAAAGAAATGTTGCCTAAGGCTGTCTGGTATTTCTTTTCAAGGGTTTTCCAGTATGA
ATGTTAATGTTGTCAGTGTATGTATGAATATGAAAGTGCTTTGTTTTGTTTGTTGCTGTT
TTTTGTTTATGTGTGTGTTTTTAATTTTTTTGTTCTTATCAGCAGTCTTGTGTTAGCACT
GGGTAAGCTTTAATTGTCCCTTAGCCAATCAAACATTAAGGACTATGGAGGTCTTTTTTT
TTTTATTTAACATGTCATTGTTCATCTATTAAATCTTGATCAGGGTTTCAAGAATGACTG
CAGTGGGTTTTGGAAACAGACTTATCATTATTGATTTGAGGTTTCCCAGAGATATAGTTC
ACAGTTAATTGTTGCGCTCTAATACAACTGACCATTTAAAATTGAACAAGTTTATTGTTT
TGTAACAATGTCAGTTGTTAAACCTTGACATTTCAATTAAAACATGAATTGTAGTTATAA
CTCAATGCAAATTCAACAGTTGTATTTGGAGTTAAATTATTTTAACAAATAAATTTATTT
AATGAA
actctggatttgctttgttttgtacatgctcatgagagaaatgtattatatacaaaaaca
attaaaaattgccatataatgaatttagtactcttcatacaaaaatattttagctgattt
gagagttcatcatataaaaaggcaggtaggtagataattttcatagtctttaaaaataaa