Gene PCCA Variant 1
DNA : 441.28 KbNT_009952
mRNA : 2426 bp NM_000282
CDS : 2112 bp NP_000273
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  78 bp
gatctggccgaccactcaccctcccctttccgcaagttagggggcggggcatcgggtttc
tggctcgtgatttgccggagctcctgcgctccccttctccaccccctccggctgtgtgag
aggtcagcagaggggcggtctgcggggacaacaatggcggggttctgggtcgggacagca
CCGCTGGTCGCTGCCGGACGGCGTGGGCGGTGGCCGCCGCAGCAGCTGATGCTGAGCGCG
GCGCTGCGGACCCTGAAG
gtgaggagcaacggggcctcgcgggtccgggcttcactgggcttctagccgtgccgcctc
tgggcggctggcgccgggagagcgctggctgggtccggctgcccccgcgccccggttccg
catcagctacaccgcttgctttcctccctcccggagttcgcgtggcagcgggctcaggag
EXON 2  78 bp
ccaaggggctgtgtctgtagatatgatttcccttttgtaattatatttatggtatattgc
ctagaactacatttattgatcagacacgttcgctagaacctaactggaagaaatatcctg
aaaaaatgttctaaagcccatcaagtatttgcaatttattttgctttcctttttttgtag
CATGTTCTGTACTATTCAAGACAGTGCTTAATGGTGTCCCGTAATCTTGGTTCAGTGGGA
TATGATCCTAATGAAAAA
gtaagtatttaaaagatattctcaacaactaaattaaacttatcatggttttactttctc
gtctccacactgtgttcagtggacagatgagattttgttaaggctgtgtggtcattgatc
actctagcattgtgtgtttctataggtgctcagtctttaggtattctgtttttcattgtg
EXON 3  48 bp
taagtatttatagtacatttaatattactgtaagtaatatagtatttaatgttactctag
gaagtaatgtttattagggttatattcagtgttgatgttggaaaaacttggtgttttttg
gtcttaaaccatcggtttaaaagtaacaatttctaatgaatgtgttttttctctcttcag
ACTTTTGATAAAATTCTTGTTGCTAATAGAGGAGAAATTGCATGTCGG
gtgagtagaattttcgtcttattttccattttactctgaaattatttattaaaccccttt
aagtgtgaatcactattaatagacattaatatattttaaaataggttattagaacttgca
agaagatgggcattaagacagttgccatccacagtgatgttgatgctagttctgtaagta
EXON 4  69 bp
ctaatgaatgtgttttttctctcttcagacttttgataaaattcttgttgctaatagagg
agaaattgcatgtcgggtgagtagaattttcgtcttattttccattttactctgaaatta
tttattaaacccctttaagtgtgaatcactattaatagacattaatatattttaaaatag
GTTATTAGAACTTGCAAGAAGATGGGCATTAAGACAGTTGCCATCCACAGTGATGTTGAT
GCTAGTTCT
gtaagtatatttttgctttgtttaaatcaggacttaattttgggtcaagcagaaaaagtg
agacatacaggctttttttcttggcctgcacaagatacattcaagtttaaaaactgttta
cttgttcactgttgtgttaagcaaaacgacagtatcacagtatcttctatatgtgccgta
EXON 5  114 bp
ggttaatagagttcctgagtttatttgttgcattgttgctttttagtgcatactcaaaaa
gaaatacgactctataaatgataggcagaacaatcagatttgcaattttgtgtgtatttg
cagatgatggtaattctttttgctgggcgcatctgttaatgcagaaatttgtctcctcag
GTTCATGTGAAAATGGCGGATGAGGCTGTCTGTGTTGGCCCAGCTCCCACCAGTAAAAGC
TACCTCAACATGGATGCCATCATGGAAGCCATTAAGAAAACCAGGGCCCAAGCT
gtgagtctgaatgaatctatctactgcagctgtttcatatgtagtgagcagaaagctaga
gtttgtatttaaaaaaaaaaataggaaagaatgattgaaaatgctgttgcagttagttca
tgtcacatgagttaaatgtggtcgaattcgctactggaaatcaaaggctttgtagcatct
EXON 6  54 bp
tcttggaatttgattctgatcctagaaatgtgagttagaactgatcagtgtataagagaa
gtgtacttattcaagggctcttgaacagtaaatattaatacataaatgcactgtacattt
tgcttataaagcttttgcaatatgataaaattgaaagtgctttttgctttcatttctaag
GTACATCCAGGTTATGGATTCCTTTCAGAAAACAAAGAATTTGCCAGATGTTTG
gtaagttggtaatgaaccagaaactgttcatttctttttcagaaagcagtgtggtagcat
ggctttgtaaatgtgggtagtgatggattatagaattttaattaacccagcagttctttg
aaaattgtgacaagtgaagtggttttagtctgaaactcaactgtttatttgaagagtaat
EXON 7  132 bp
atctatccacacatgtactatatgcaatatagtattttaatgtgttggctcaaaaactgt
tgtttctgcaataaaaataattagaaaatacacatatgggcttttcttttataaaattgt
gactccacatcatgctccgtaatgttcttgttataaattttgacttgtttttctccacag
GCAGCAGAAGATGTCGTTTTCATTGGACCTGACACACATGCTATTCAAGCCATGGGCGAC
AAGATTGAAAGCAAATTATTAGCTAAGAAAGCAGAGGTTAATACAATCCCTGGCTTTGAT
GGAGTAGTCAAG
gtgagaagctactttaacttttattgtatatgtcttcaagttaaacattttgtcaaaagt
ataagataaaatgtaactattgcttttttgggatatacacacacacacacacatatgcac
gcacatacatacatgtatatatgtttaaaaaatcagtgtttttacatttatttatttatt
EXON 8  37 bp
agaatttacattccacttatggtattaattttacatttctctgaatgaaaagggttagaa
ggtagtaaaattgaacattaaatgaatcggaggagacagtagtgcaatatatgactgccc
taaagacattgtgcaatgcctcatgggattaatgttgagtctcatttcctgcttttacag
GATGCAGAAGAAGCTGTCAGAATTGCAAGGGAAATTG
gtaagtccttaaattaactttggtaggatttctgtgtctttcagcagatacggttgagtc
aacaggtaataagtaattcccatagagcaaataatactttaatagttttagattttgatt
acttgttgctctggaagaatgtatcagttgaattgccaaattctattattaaaggagact
EXON 9  79 bp
tttaaatacatcattacactggtgttactttcctggtgttattttcctgactctaaagaa
aggaacttttaaataaattaattattgttttctgcgttattgaacatgtggtcaattgtc
atgttcatacatcccaatgatcaaagtctgaacttctgtctaattcttccctgctgttag
GCTACCCTGTCATGATCAAGGCCTCAGCAGGTGGTGGTGGGAAAGGCATGCGCATTGCTT
GGGATGATGAAGAGACCAG
gtgagaggctgtccaaaatatacttttgatgaaaattgcagttaccagagttttattaaa
ctgacaggtaaacagataccaaaagcataatggagtaattacagtaaccatctaattttt
acacttttgaatgggaaaaagattgaaattatgtggaaaccttccttatttatattttga
EXON 10  103 bp
tatattgagtaaaggtttttgcttttttcagaataagccaaaataaatatttaatcgatt
gtgttttcttttataatgatagctctatttgttttgttagtctgactcttcttctccttc
ttccccttccccttcccctccctctccccccctcctccttcttccttctttttttcacag
GGATGGTTTTAGATTGTCATCTCAAGAAGCTGCTTCTAGTTTTGGCGATGATAGACTACT
AATAGAAAAATTTATTGATAATCCTCGTCATATAGAAATCCAG
gttggtacatttaagatgctttttcattattattttaaaataatatcatttaatcctatt
ggaattatcttttcttccatttagaatgattgtgagttgtgcctttagaatctgttgtac
tttccgttaaagtgctaggatgttggttgggattgggaatgatacaaaaatctacctcca
EXON 11  95 bp
ttggagtaataaatatagttttcctttgttaacatgaatcaaaataatgttttgagaggt
atgtatatactatgaagtttgaatattaaaaaccaagagatgttgcatgcggaaaatatt
aaccatcatctactttgtgggtgtggttatatggtttttcaaatggtattgctctttcag
GTTCTAGGTGATAAACATGGGAATGCTTTATGGCTTAATGAAAGAGAGTGCTCAATTCAG
AGAAGAAATCAGAAGGTGGTGGAGGAAGCACCAAG
gtaagtctcctaagaaacatttataaagcggctgcttttatgcatttcattcattcattc
attcattcatcattcactgacgcatgcattcagagacagggtctcactctgttgcccagg
cagtggtgcaatcacggctcactgcagcctccacctcccaggctcaagtgatcctcccaa
EXON 12  151 bp
tgcttaataatatagtcaacatatattataaaacatatataaagcacaatattttgaatt
cttaaattggtatagatgatctatatctgagtaaactttaagaaaatgtttatgtaatgc
acacaaaagataacttgatttttgtccgaaatgtagacaaacatttttttgtatatgtag
CATTTTTTTGGATGCGGAGACTCGAAGAGCGATGGGAGAACAAGCTGTAGCTCTTGCCAG
AGCAGTAAAATATTCCTCTGCTGGGACCGTGGAGTTCCTTGTGGACTCTAAGAAGAATTT
TTATTTCTTGGAAATGAATACAAGACTCCAG
gtaacaacaactgttatttattcctctccatgcctctgtactttacccttccttctccac
ccttttttgttttataaatgttaaaaaattaactccataaagtgttaaataaagatttag
tttttatgcttgtgctaagacatctgttaggaatgacggatagtatccctctaaagttca
EXON 13  144 bp
tgtgtattgtgtttattctttcattttattcccctagctcaagagttttttagtcaaata
tgttcaaatgttacattcgattaacttcattttacccaaaaacttttgtgatttttcttg
tttgtttctatttatttacccttttctacacctactgactggcagaccttggccttgcag
GTTGAGCATCCTGTCACAGAATGCATTACTGGCCTGGACCTAGTCCAGGAAATGATCCGT
GTTGCTAAGGGCTACCCTCTCAGGCACAAACAAGCTGATATTCGCATCAACGGCTGGGCA
GTTGAATGTCGGGTTTATGCTGAG
gtaaaatgaatggtgttgggaggaaggatggtggttatgtccagagtcatgagacctggt
atagccaaacaatgaggtaaagttagggttttataatgttgccaactattggattacgta
atccataattaaatcagaaaaaaattagataattttgacctaattccagatagttttaaa
EXON 14  75 bp
tttttaagtacattctaagttgtctagcgtaaaagacaataatattctgaaatctgtgat
ttggtaaataccatatgttgaaaatagacctataaatggttcttcattgtgtaaatattt
aaccttacttgtgctgatttatatttcaaagactgtgcttcctttcctttgaactttcag
GACCCCTACAAGTCTTTTGGTTTACCATCTATTGGGAGATTGTCTCAGTACCAAGAACCG
TTACATCTACCTGGT
gtaagtcattaagctgtaataccagctgaagggttaaaatcgtgatttatgtcatacttt
tatgttaaagcatgtcaacaccaaagggtgtaaattgaaggacaagtgaaattcatggga
atcatggtttttgtgttgaaaacaaatttttttcagtattttgtggtgttcaagaaagtc
EXON 15  69 bp
tgtgttgcattacatattaacggatcaagattttagattgttttcctattttccagaagt
tgaaatgttatttgagattgaaattctctatccattttctccatggaaatgaaattggtg
gttacaaaaaaatatctacacaatatgaattacttttctttttttctttttttctcccag
GTCCGAGTGGACAGTGGCATCCAACCAGGAAGTGATATTAGCATTTATTATGATCCTATG
ATTTCAAAA
gttagtttaatttctcaatggattatttgatttcttcgaaaaatcaatgatatttaaaga
gtctgaaactgggcctttatctgaatcataagctataattaaacaactaattatgcactg
atgtaaatgtgaaagcagagcaggttttttctcttgagagaaaattcagcgttatgttag
EXON 16  76 bp
attctaatatttatatacttaaaaaatcataattgacatgtattgaaaactgaactatca
taaaatttcgagatatatttagaaatctgttatgaaatattttaatttttactaaaatga
atcatttaacatagttctaaatatatatatatattgggttttttgtttgcttgtttttag
CTAATCACATATGGCTCTGATAGAACTGAGGCACTGAAGAGAATGGCAGATGCACTGGAT
AACTATGTTATTCGAG
gtaaaaacaaagatttgcactcgttggttattgtatatggtgtccagttccagagaacag
cctgggggtttaccaatgagaatatggcacagcacatttgctcactatgtgcttaaagag
aaataagaaaaactcaaatccatcaaaccaccataccaagtatagccgtttccactgttt
EXON 17  111 bp
agtgttttattgataccacaagttcagatattttttgttgttaatagaattcaaggaaat
aagtaatcttgaatggtttctgctaggtcatagaacagtgatgataaatttctccagatt
atcagaattcaatttttcactgattcattgttcttcaatttgatatcattttacttttag
GTGTTACACATAATATTGCATTACTTCGAGAGGTGATAATCAACTCACGCTTTGTAAAAG
GAGACATCAGCACTAAATTTCTCTCCGATGTGTATCCTGATGGCTTCAAAG
gtttgtatgcattaaaatattttagtgttttaaagttgttatttttatactttattgtaa
tacataatttcactctattttgaaattaaggccttttggcttatattatacttcattttt
agaacatgcaagactgtttacattcatgattttgagtatttatggatgactcatgagtgt
EXON 18  103 bp
gtcttatttgaatggtcttgcttcctcaatgtccgcacaccccagtgcctagtacaatcc
tagctgcataatagatgccctataaaatacttgtttgaatgactagtaattctataggag
agaagcacagatgttaaaataaatgattgattgattgattggttgattgatttccctcag
GACACATGCTAACCAAGAGTGAGAAGAACCAGTTATTGGCAATAGCATCATCATTGTTTG
TGGCATTCCAGTTAAGAGCACAACATTTTCAAGAAAATTCAAG
gtatggtagatcatttaaaacagaataaatgagcagaacaatattgataatccagtctac
ataggaaatactaataaaagatgtggctgatctcagttctagagatcttatgggtctttg
gagaagtataataaagtcacactgtataaatatgatattgcttacattttgtttaaacaa
EXON 19  103 bp
gtaacaattaggcaattcaaattcatagatacatgatgattcttagagtaggtgtttaaa
atgttcgcaaatacattcaatggcagttttagcctgtgcattttatatcaaagggaaatt
agtttattgagaaataataatataaaattattaactctttttcttttcattctacttcag
AATGCCTGTTATTAAACCAGACATAGCCAACTGGGAGCTCTCAGTAAAATTGCATGATAA
AGTTCATACCGTAGTAGCATCAAACAATGGGTCAGTGTTCTCG
gtgagttttctttctttattttcttggtaatcttgatgttatctatgaatatttaaagcc
atttttaacctgttcagtgactctcgtcttttgaatttgtagtacctctatgtatttttc
atcttctttaggaagctgaatggaaatggaaatttttgttctcttatgcttattaggaaa
EXON 20  99 bp
ccagagatgactgggaagacgctgttgttggaccctgtctttcttggctggagcagtaaa
catgacaggttgtttgggagccatctgtttaaaatggctgctgctttgtatgcagcaatg
aacttgagatcagttttctgtctttcttcatggtaatggtcttatttggtgtcacaacag
GTGGAAGTTGATGGGTCGAAACTAAATGTGACCAGCACGTGGAACCTGGCTTCGCCCTTA
TTGTCTGTCAGCGTTGATGGCACTCAGAGGACTGTCCAG
gtgagtgttgtaaggatttccttagagggcctcctcaagtccagaatccttgtcagcacc
tgtgtggctaatacttagagctataggagggaaaagctgtattttattcaccttatactt
tttacagtcgaaaactttttcttttcttattttagaggatcttaagttttaacctgagca
EXON 21  54 bp
gtagcatgtatcactacttcattcctttttatggccaaataatattccactgtatggcta
tactatattttgtttacccatccatcagttgatggacatttgggttttttggctatcgtg
aacattacatacaagctgtgcagatatgagttcattttatatctcttgtttgttttttag
TGTCTTTCTCGAGAAGCAGGTGGAAACATGAGCATTCAGTTTCTTGGTACAGTG
gtaagtatgaaatcattctttattctcttaatttacagagaaaaaatgttcaactagttg
tagctcatgtgtttgaacttggcttcattactgctagatatttaaattacctctactttt
ttgcctttacaaatgatattctagggaacaacttcatatatttcactttattttagtgtt
EXON 22  141 bp
agctcaatatatgacagaaacaaatatattttgatgtgtgcagcaattgagaaccatttg
aatttaaggctcttactgtaatttgaatttaaaagctaaaaattgatttagaatgaatgc
tacttttgaggaaaatttcatttaaactcatttatggtttggttttgtttttcccttaag
TACAAGGTGAATATCTTAACCAGACTTGCCGCAGAATTGAACAAATTTATGCTGGAAAAA
GTGACTGAGGACACAAGCAGTGTTCTGCGTTCCCCGATGCCCGGAGTGGTGGTGGCCGTC
TCTGTCAAGCCTGGAGACGCG
gtaagggctgtgtgtgtctctctgcaggacatgctggtctccaacttccccttccaaagc
gacggctaacggcacagcacgattcggctctttgcagttcttacttaaccgacgccccct
aaacagcaaaatcgattgcgtgtgttgtcgacctgtttcacgtttgcattacgttggtgc
EXON 23  78 bp
atggcttttctctactgttcctaaagatgagcttggaataggaaacattagagattgttg
ctgctgttcatagacacatattttggggcatttgacaaagaatttcttaatggcttcatt
cctaagtgttaatgcaaaattagaatgcttttaaaacttctgcccatttttgttttccag
GTAGCAGAAGGTCAAGAAATTTGTGTGATTGAAGCCATGAAAATGCAGAATAGTATGACA
GCTGGGAAAACTGGCACG
gtgagtccctaagtccccatcagcccaggccggccctgtgatggaggaacgcccaccttt
gaatcgtgggtggtttggctggaaagggccacagaggcgccctctccccctcgcttctac
agaggaggacgttaggattgggagcttttgccattctgccctgatgcatccctgcctcgt
EXON 24  335 bp
tggcgcctccctgttcaccagggtcccttcgatgggctccggtggggtggggtggcttgt
ccctgtgctgctgagcttgcaggactgtgcatttttagaaatggattaggagcctgccgc
ctcttggttctggttactaattcttactctcccctccccctgcatttttcaaaattcaag
GTGAAATCTGTGCACTGTCAAGCTGGAGACACAGTTGGAGAAGGGGATCTGCTCGTGGAG
CTGGAATGAAGGATTTATAACCTTTCAGTCATCACCCAATTTAATTAGCCATTTGCATGA
TGCTTTCACACACAATTGATTCAAGCATTATACAGGAACACCCCTGTGCAGCTACGTTTA
CGTCGTCATTTATTCCACAGAGTCAAGACCAATATTCTGCCAAAAAATCACCAATGGAAA
TTTTCATTGATATAAATACTTGTACATATGATTTGTACTTCTGCTGTGAGATTCCCTAGT
GTCAAAATTAAATCAATAAAACTGAGCATTTGTCT
aaatattagtttgccctttctttgaatgaagacaatgtacacataggcgacaggctctgc
cagtagactaccagcatttctttgtgatccttttaagagattgatataaatgtcagtcag
ttctctgccttgctttattaaattagcacttgccattttttcatctgattgccttactac