Gene MBNL2 Variant 2
DNA : 171.76 KbNT_009952
mRNA : 4665 bp NM_144778
CDS : 767 bp NP_005748
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  177 bp
actgtttttacacactgcaagtgctgtgttactgtgtcagtcatcctattagggccagtt
tcagacgagtagggctgacgagctggctggggattggctggccccggctgggagggattt
gtcggaaggaagggctgcagcttacagcaacagagtttagactgtctttgcttcatcatc
TGAAGGTAAAATTTTCCAGATACGGCAGACGGCTTTCAGAGTACAATAAACAGGGAATGA
GAACTATTTACATGGAAGTTTCTTTCTCATGATGCGGTGGAGAAGCCTCGGCCACTTGGT
TCTGCCAGATGTTCCTGGGGTTACTGTAAATGGGAAGGACAGGCAGAGCTAAACAAG
gtaggagaatcgccccccttttttgaatgtttaaagagtttgctgcagtatgctgcattc
catgtgtgctgcttacgggagccagggaaactggattccactaattcaattgtaatactt
gcgggggaccctggagttttacgtaacattttgatttgagaaaaagaaatggcaaagctt
EXON 2  778 bp
gcaatacggtttccgttgcatattcttttttttatttaatgcataacttttctcactata
ctcaaagctcaaagctctaaactgtgcttttgcaaattctagataagagttcaatagttc
gttgaagtggtgattccattgagtttgtgtaaaggttaatatttcatttctgttttgcag
GTTTATCATTTAAAAGTGCCTGTGTGAAGTCACTTTTGCTGGAAAACTGCAGCTTGGGAG
CTTTCTTTGTATTCACATCCCACTCTTCTGTCAAGTACACTTTACCCTGACCTTATGAGT
GGATGAAGATACCTCAGTTGTCTGACTTTGCCAATTGCTTAATTTCAGAATTTAAAAAGG
GGAAAGAAAAACATCCTGCTAAAATATGAACATCTGAGTGTCTTATTTTCCAACATCGTC
AATAGCTGTGAGCGTCAGCATTAAATATTCTCCCAAGGAGTGCCATGATATTGAAGTCAC
TTTATTAATAACAGCTGTATCTGCAAAACAGTCAAGAGACTCGGACGTTGAAAGCCAGAG
ATGACACTGAGCATGCTTTTATTGCGGCCTACCATCTTTAAGTGGGACATATTGATTGAT
GAGTGATTGCCTGTCCATACACTCTCTCATCATCCTGTTCCTTGGATTGGACTTCACTAA
GCAATTTATCACTCACCTTCAGACTTACATGTGGGAGTTTTCACAACAGTAGTTTTGGAA
TCATTAGAACTTGGATTGATTTCATCATTTAACAGAAACAAACAGCCCAAATTACTTTAT
CACCATGGCTTTGAACGTTGCCCCAGTCAGAGATACAAAATGGCTGACATTAGAAGTCTG
CAGACAGTTTCAAAGAGGAACATGCTCACGCTCTGATGAAGAATGCAAATTTGCTCATCC
CCCCAAAAGTTGTCAGGTTGAAAATGGAAGAGTAATTGCCTGCTTTGATTCCCTAAAG
gtaagagaatgcgttttatgtgtcatttcaataccacattggaattgcaaacagaaggct
tttcattgcatttttacagaagtttaaaaattgcttttagattctattttcttgtttgtg
gtgactgttgggagatttttcactcaaattttttcatatcaggcatatataaatttttta
EXON 3  165 bp
taatgtttgattcacttttccccaacaaacacatgagcatgcgcgcgcacacccacacac
acacacacacacacacacacaggatccttgcttttgtgcataagaagtgattgttcagtg
gttgactttggagttgcaagctacttaaaatagtcctaaaaccaacacttgtttttacag
GGCCGTTGTTCGAGAGAGAACTGCAAGTATCTTCACCCTCCGACACACTTAAAAACTCAA
CTAGAAATTAATGGAAGGAACAATTTGATTCAGCAAAAAACTGCAGCAGCAATGCTTGCC
CAGCAGATGCAATTTATGTTTCCAGGAACACCACTTCATCCAGTG
gtgagtacatctttattcagtgatgagttggatggttacagtgttggtatggatgatgcc
acgttgacctagggtggcctctctccactttgtcactttggttacaattaaagcaaatag
ctttaaagctcaatagatgaaggaaaataggcttttaaaaaaattaatagaaaaatattt
EXON 4  201 bp
ctgtatggtttggggaagagagggtctacatggatgtcatttttattataggtcagcatt
gagctatacaattaacacagagtatatgatgaatacattttgctcaaatgacatttgctg
gtaattttttaaagttttattctaaataactctttctcctgtgttgtcttcctttaacag
CCCACTTTCCCTGTAGGTCCCGCGATAGGGACAAATACGGCTATTAGCTTTGCTCCTTAC
CTAGCACCTGTAACCCCTGGAGTTGGGTTGGTCCCAACGGAAATTCTGCCCACCACGCCT
GTTATTGTTCCCGGAAGTCCACCGGTCACTGTCCCGGGCTCAACTGCAACTCAGAAACTT
CTCAGGACTGACAAACTGGAG
gtacttcaattctacttgtgttttgacatgcatttgtggtagaaatatacttctgtgtaa
gtgattgcttgtaagatattaattcagtcttgcaaaacagccatgtaaacacacacacac
aaactcacctaaaacccatgtattcataactctgtggtttgaagttaaggccaagtataa
EXON 5  264 bp
aaatgactgtgtcagagattgtggttacctgggctccgcataatcaatcttttcttgtca
gtggtacatgagccaccattgaaagcgaggcagcctccgctcctcccgcggtggccgggg
ccgcaggggcgcctgggctcaggcttgcctctgcagcgcggctcttcttccctgtcttag
GTATGCAGGGAGTTCCAGCGAGGAAACTGTGCCCGGGGAGAGACCGACTGCCGCTTTGCA
CACCCCGCAGACAGCACCATGATCGACACAAGTGACAACACCGTAACCGTTTGTATGGAT
TACATAAAGGGGCGTTGCATGAGGGAGAAATGCAAATATTTTCACCCTCCTGCACACTTG
CAGGCCAAAATCAAAGCTGCGCAGCACCAAGCCAACCAAGCTGCGGTGGCCGCCCAGGCA
GCCGCGGCCGCGGCCACAGTCATG
gtaagtgcggccgcccgccgcccctgcaccccggcgcctctgcggaggccgctccgggct
gggacttggatgttcttccaaacactcgggaaacatggaaggctgctattcctgctgctc
cgctgcctaagttttgctgttgttttccccctttttgttttgttttgttttcccctcctg
EXON 6  154 bp
tcgctctcaataacaaattctcactcattcgacattgccgctgtttaaattaaggtgcat
ggcagaggcatctccttagctgtcatttttaaaaagaatgttgcaattgatgatctctgt
gaacatggaaggtgtgtttgctttaagttagacatatcttatcgaattcttcatttctag
GCCTTTCCCCCTGGTGCTCTTCATCCTTTACCAAAGAGACAAGCACTTGAAAAAAGCAAT
GGTACCAGCGCGGTCTTTAACCCCAGCGTCTTGCACTACCAGCAGGCTCTCACCAGCGCA
CAGTTGCAGCAACACGCCGCGTTCATTCCAACAG
gtatgtgcccttactgccctacgtcctgtgcccttctggtcatgtgctttcttctcattt
ctctaagctgtttggtggcatctagtttgcttttgaaggtataatacagtttgaaattca
tcgttgtcctagctatctaaatgtatttaccttactttgaatgatagctaaagactgtta
EXON 7  36 bp
taaaataagtcagatatatttgtgtctgtactgacaatgtgaatggccctaaaagactgt
gttaactaaccctacttatttctggttgtgcttcaatctcactttgaatgttaactctaa
accgctaacctgtttctttccctttattcactttttccacccaccattgcatgacatcag
GGTCAGTTTTGTGCATGACACCCGCTACCAGTATTG
gtaggtttcaaccttttttatttgtcttttatatgatgtacaataccttcacttgcttga
aatttatttcagagatggtagaaatgctataggaaatagtagatttgaaggcttatttgg
ctttagagttaacatataggtttttaaaaatgtacttgtatatttaagaaaatgacggtt
EXON 8  95 bp
ctattttcccttttttatttctctcccatgcttccttgctttgcattgtgattgcatgcc
atctgctggtttaacccatgatggcttgctgctctgatattcaccatgccaaaataccac
ttctattaccataatgctacaccctcctgttcattgctcccatggttcccctcctgaaag
TACCCATGATGCACAGCGCTACGTCCGCCACTGTCTCTGCAGCAACAACTCCTGCAACAA
GTGTCCCCTTCGCAGCAACAGCCACAGCCAATCAG
gtttgctccttttaaagctttctttcacaaatcccaaactctaaatgagtgctgatattt
aaaaaaaaaattctcggtgagaatttttttttcatgtttatccatcaaattttatttttt
taattagtttatagcaagcatttacagacaggttgcacttatttagagttaacatttact
EXON 9  2795 bp
aagtgtaaagtttttcagcatgaagggcgggtattgtgcaaatttataattgcatcaaaa
taatgagagattgaagaaaactctgattttcaaatgtctatttttgaagagtaaaactta
aactcattatttttcctcccagaaggatacctaaatcatgcttgtctttctctttaacag
ATAATTCTGAAATAATCAGCAGAAACGGAATGGAATGCCAAGAATCTGCATTGAGAATAA
CTAAACATTGTTACTGTACATACTATCCTGTTTCCTCCTCAATAGAATTGCCACAAACTG
CATGCTAAATAAAGATGTAGTTCTTCTGGACAGACCACAACTCTAAGAAGCTAGTGCTGC
TATCTCATATATGAGTATTAAATATGGTATGCTTAGTATATTCCAACCTAAGATAGTTAA
CTACCTGAGACCAGCTGTGATGTTTAAAGACATAAAGGATAAAGTTTACTTTTAAAGGGT
TTCTAAACATAGTTTCTGTCCTAGGAATATTGTCTTATCTCCATAACTATAGCTGATGCA
GAAAGTCCAGCCAGTTTACTCATTTCGATTCAGAATATTTCAAATTTAGCAATAAACAAT
TAGCATTAGTTAAAAAAGAAACATATTCCAAGGGCAGGTTCGATTCTAGCTCTAATTACT
GTCATGTCATTTACCCACTGGATCAAAGGGTATGTTTCACTTCTTGACAATATAAATGCT
GCAGCAAAGATGAGAGGTGAAGTAAAACCGATACCTGTCCTGCAGGTCTAAAATTTGAAT
GGAAATTCAAGCACAAGTACTGGGGACACATCAAAGTGTGGTGTTTGGTTTGCCTGGAGA
TGCCACGTTGAATCATGTGATTCTAGATTAACATTAAATAGATTGAAAAAGAAACTTTGC
ACGGTATGAGCTTCATACCCCACCAAACAAAGTCTTGAAGGTATTATTTTACAAGTATAT
TTTTAAAGTTGTTTTATAAGAGAGACTTTGTAGAAGTGCCTAGATTTTGCCAGACTTCAT
CCAGCTTGACAAGATTGAGAGGCCCATGCCAACAGTCTAATCTAAGAGATTAGTCTTTCA
AACTCACCATCCAGTTGCCTGTTACAGAATAACTCTTCTTAACTAAAAACCTAGTCAAAC
AAGGAAGCTGTAGGTGAGGAGATCTGTATAATATTCTAATTTAAGTAAGTTTGAGTTTAG
TCACTGCAAATTTGACTGTGACTTTAATCTAAATTACTATGTAAACAAAAAGTAGATAGT
TTCACTTTTTAAAAAATCCATTACTGTTTTGCATTTCAAAAGTTGGATTAAAGGGTTGTA
ACTGACTACAGCATGGAAAAAAATAGTTCTTTTAATTCTTTCACCTTAAAGCATATTTTA
TGTCTCAAAAGTATAAAAAACTTTAATACAAGTACATACATATTATATATACACATACAT
ATATATACTATATATGGATGAAACATATTTTAATGTTGTTTACTTTTTTAAATACTTGGT
TGATCTTCAAGGTAATAGCGATACAATTAAATTTTGTTCAGAAAGTTTGTTTTAAAGTTT
ATTTTAAGCACTATCGTACCAAATATTTCATATTTCACATTTTATATGTTGCACATAGCC
TATACAGTACCTACATAGTTTTTAAATTATTGTTTAAAAAACAAAACAGCTGTTATAAAT
GAATATTATGTGTAATTGTTTCAAACATCCATTTTCTTTGTGAACATATTAGTGATTGAA
GTATTTTGACTTTTGAGATTGAATGTAAAATATTTTAAATTTGGGATCATCGCCTGTTCT
GAAAACTAGATGCACCAACCGTATCATTATTTGTTTGAGGAAAAAAAGAAATCTGCATTT
TAATTCATGTTGGTCAAAGTCGAATTACTATCTATTTATCTTATATCGTAGATCTGATAA
CCCTATCTAAAAGAAAGTCACACGCTAAATGTATTCTTACATAGTGCTTGTATCGTTGCA
TTTGTTTTAATTTGTGGAAAAGTATTGTATCTAACTTGTATTACTTTGGTAGTTTCATCT
TTATGTATTATTGATATTTGTAATTTTCTCAACTATAACAATGTAGTTACGCTACAACTT
GCCTAAAACATTCAAACTTGTTTTCTTTTTTCTGTTTTTTTCTTTGTTAATTCATTTAAA
CTCATTGAAAACATAGTATACATTACTAAAAGGTAAATTATGGGAATCACTGAAATATTT
TTGTAGATTAATTGTTGTAACATTGTCTTTCTTTTTTTTCTTTTGTTTCATGATTTTGAT
TTTTAAAATTATTAGCACACAACTATTTTCAGCCCTTTAATAATGGAGCATCAAAAACAT
CACCTGTAACCCCAAGCAAATATAGAAGACTGTATTTTTTACTATGATATCCATTTTCCA
GAATTGTGATTACAATATGCAAAGAGTCATAAATATGCCATTTACAATAAGGAGGAGGCA
AGGCAAATGCATAGATGTACAAATATATGTACAACAGATTTTGCTTTTTATTTATTTATA
ATGTAATTTTATAGAATAATTCTGGGATTTGAGAGGATCTAAAACTATTTTTCTGTATAA
ATATTATTTGCCAAAAGTTTGTTTATATTCAGAAGTCTGACTATGATGAATAAATCTTAA
ATGCTTTGTTTAATTAAAAAACAAAAATCACCAATATCCAAGACATGAAGATATCAGTTC
AACAAATACTGTAGTTAAGAGACTAACTCTCCACTTGTATGGGAACTACATTTCACTCTT
GGTTTTCAGGATATAACAGCACTTCACCGAAATATTCTTTCAGCCATACCACTGGTAACA
TTTCTACTAAATCTTTCTGTAACACTTAAAGAATTCCCTCATTCATTACCTTACAGTGTA
AACAGGAGTCTAATTTGTATCAATACTATGTTTTGGTTGTAATATTCAGTTCACTCACCC
AATGTACAACCAATGAAATAAAAGAAGCATTTAAA
aggattgtatagtcttccttctttttgtgttgagacagattgataattcaccaaacaaaa
tagttttcaccttcacacatacagtatttgttaacttcaaagaagaccaaactcgggtct
tcgaatggaaaactgatagtttttgcttttggctttggctttttagcagcaagaaaaaca