Gene MBNL2 Variant 1
DNA : 169.65 KbNT_009952
mRNA : 2567 bp NM_005757
CDS : 0 bp
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  178 bp
cactgtttttacacactgcaagtgctgtgttactgtgtcagtcatcctattagggccagt
ttcagacgagtagggctgacgagctggctggggattggctggccccggctgggagggatt
tgtcggaaggaagggctgcagcttacagcaacagagtttagactgtctttgcttcatcat
CTGAAGGTAAAATTTTCCAGATACGGCAGACGGCTTTCAGAGTACAATAAACAGGGAATG
AGAACTATTTACATGGAAGTTTCTTTCTCATGATGCGGTGGAGAAGCCTCGGCCACTTGG
TTCTGCCAGATGTTCCTGGGGTTACTGTAAATGGGAAGGACAGGCAGAGCTAAACAAG
gtaggagaatcgccccccttttttgaatgtttaaagagtttgctgcagtatgctgcattc
catgtgtgctgcttacgggagccagggaaactggattccactaattcaattgtaatactt
gcgggggaccctggagttttacgtaacattttgatttgagaaaaagaaatggcaaagctt
EXON 2  778 bp
gcaatacggtttccgttgcatattcttttttttatttaatgcataacttttctcactata
ctcaaagctcaaagctctaaactgtgcttttgcaaattctagataagagttcaatagttc
gttgaagtggtgattccattgagtttgtgtaaaggttaatatttcatttctgttttgcag
GTTTATCATTTAAAAGTGCCTGTGTGAAGTCACTTTTGCTGGAAAACTGCAGCTTGGGAG
CTTTCTTTGTATTCACATCCCACTCTTCTGTCAAGTACACTTTACCCTGACCTTATGAGT
GGATGAAGATACCTCAGTTGTCTGACTTTGCCAATTGCTTAATTTCAGAATTTAAAAAGG
GGAAAGAAAAACATCCTGCTAAAATATGAACATCTGAGTGTCTTATTTTCCAACATCGTC
AATAGCTGTGAGCGTCAGCATTAAATATTCTCCCAAGGAGTGCCATGATATTGAAGTCAC
TTTATTAATAACAGCTGTATCTGCAAAACAGTCAAGAGACTCGGACGTTGAAAGCCAGAG
ATGACACTGAGCATGCTTTTATTGCGGCCTACCATCTTTAAGTGGGACATATTGATTGAT
GAGTGATTGCCTGTCCATACACTCTCTCATCATCCTGTTCCTTGGATTGGACTTCACTAA
GCAATTTATCACTCACCTTCAGACTTACATGTGGGAGTTTTCACAACAGTAGTTTTGGAA
TCATTAGAACTTGGATTGATTTCATCATTTAACAGAAACAAACAGCCCAAATTACTTTAT
CACCATGGCTTTGAACGTTGCCCCAGTCAGAGATACAAAATGGCTGACATTAGAAGTCTG
CAGACAGTTTCAAAGAGGAACATGCTCACGCTCTGATGAAGAATGCAAATTTGCTCATCC
CCCCAAAAGTTGTCAGGTTGAAAATGGAAGAGTAATTGCCTGCTTTGATTCCCTAAAG
gtaagagaatgcgttttatgtgtcatttcaataccacattggaattgcaaacagaaggct
tttcattgcatttttacagaagtttaaaaattgcttttagattctattttcttgtttgtg
gtgactgttgggagatttttcactcaaattttttcatatcaggcatatataaatttttta
EXON 3  165 bp
taatgtttgattcacttttccccaacaaacacatgagcatgcgcgcgcacacccacacac
acacacacacacacacacacaggatccttgcttttgtgcataagaagtgattgttcagtg
gttgactttggagttgcaagctacttaaaatagtcctaaaaccaacacttgtttttacag
GGCCGTTGTTCGAGAGAGAACTGCAAGTATCTTCACCCTCCGACACACTTAAAAACTCAA
CTAGAAATTAATGGAAGGAACAATTTGATTCAGCAAAAAACTGCAGCAGCAATGCTTGCC
CAGCAGATGCAATTTATGTTTCCAGGAACACCACTTCATCCAGTG
gtgagtacatctttattcagtgatgagttggatggttacagtgttggtatggatgatgcc
acgttgacctagggtggcctctctccactttgtcactttggttacaattaaagcaaatag
ctttaaagctcaatagatgaaggaaaataggcttttaaaaaaattaatagaaaaatattt
EXON 4  201 bp
ctgtatggtttggggaagagagggtctacatggatgtcatttttattataggtcagcatt
gagctatacaattaacacagagtatatgatgaatacattttgctcaaatgacatttgctg
gtaattttttaaagttttattctaaataactctttctcctgtgttgtcttcctttaacag
CCCACTTTCCCTGTAGGTCCCGCGATAGGGACAAATACGGCTATTAGCTTTGCTCCTTAC
CTAGCACCTGTAACCCCTGGAGTTGGGTTGGTCCCAACGGAAATTCTGCCCACCACGCCT
GTTATTGTTCCCGGAAGTCCACCGGTCACTGTCCCGGGCTCAACTGCAACTCAGAAACTT
CTCAGGACTGACAAACTGGAG
gtacttcaattctacttgtgttttgacatgcatttgtggtagaaatatacttctgtgtaa
gtgattgcttgtaagatattaattcagtcttgcaaaacagccatgtaaacacacacacac
aaactcacctaaaacccatgtattcataactctgtggtttgaagttaaggccaagtataa
EXON 5  200 bp
aaatgactgtgtcagagattgtggttacctgggctccgcataatcaatcttttcttgtca
gtggtacatgagccaccattgaaagcgaggcagcctccgctcctcccgcggtggccgggg
ccgcaggggcgcctgggctcaggcttgcctctgcagcgcggctcttcttccctgtcttag
GTATGCAGGGAGTTCCAGCGAGGAAACTGTGCCCGGGGAGAGACCGACTGCCGCTTTGCA
CACCCCGCAGACAGCACCATGATCGACACAAGTGACAACACCGTAACCGTTTGTATGGAT
TACATAAAGGGGCGTTGCATGAGGGAGAAATGCAAATATTTTCACCCTCCTGCACACTTG
CAGGCCAAAATCAAAGCTGC
gcagcaccaagccaaccaagctgcggtggccgcccaggcagccgcggccgcggccacagt
catggtaagtgcggccgcccgccgcccctgcaccccggcgcctctgcggaggccgctccg
ggctgggacttggatgttcttccaaacactcgggaaacatggaaggctgctattcctgct
EXON 6  27 bp
gcacaccccgcagacagcaccatgatcgacacaagtgacaacaccgtaaccgtttgtatg
gattacataaaggggcgttgcatgagggagaaatgcaaatattttcaccctcctgcacac
ttgcaggccaaaatcaaagctgcgcagcaccaagccaaccaagctgcggtggccgcccag
GCAGCCGCGGCCGCGGCCACAGTCATG
gtaagtgcggccgcccgccgcccctgcaccccggcgcctctgcggaggccgctccgggct
gggacttggatgttcttccaaacactcgggaaacatggaaggctgctattcctgctgctc
cgctgcctaagttttgctgttgttttccccctttttgttttgttttgttttcccctcctg
EXON 7  54 bp
tgtgcatgcctagtgttttgtacgttgtatattgcattcagaatatttttttccttctca
cctatccacaatgcaatgccgttcccatgatgcacctctgcttgctgtttacctgtatgt
taattcgcttgaatcccattggcccactgccatcatgtgctcgctgcctgttattaaaag
ACTCAGTCGACTGCCAAAGCAATGAAGCGACCTCTCGAAGCAACTGTAGACCTG
gtactttgacctttcacctttcgctttgcatgtagcttttcagagaaccatctgagattt
gtattacttgtaaaatactggttgcaaacaatcattattattaatttatggaaaaaatcc
aataaggtgtttagccatctcattctcatatgtaatctgtgaaataaattaatcctaaca
EXON 8  154 bp
tcgctctcaataacaaattctcactcattcgacattgccgctgtttaaattaaggtgcat
ggcagaggcatctccttagctgtcatttttaaaaagaatgttgcaattgatgatctctgt
gaacatggaaggtgtgtttgctttaagttagacatatcttatcgaattcttcatttctag
GCCTTTCCCCCTGGTGCTCTTCATCCTTTACCAAAGAGACAAGCACTTGAAAAAAGCAAT
GGTACCAGCGCGGTCTTTAACCCCAGCGTCTTGCACTACCAGCAGGCTCTCACCAGCGCA
CAGTTGCAGCAACACGCCGCGTTCATTCCAACAG
gtatgtgcccttactgccctacgtcctgtgcccttctggtcatgtgctttcttctcattt
ctctaagctgtttggtggcatctagtttgcttttgaaggtataatacagtttgaaattca
tcgttgtcctagctatctaaatgtatttaccttactttgaatgatagctaaagactgtta
EXON 9  36 bp
taaaataagtcagatatatttgtgtctgtactgacaatgtgaatggccctaaaagactgt
gttaactaaccctacttatttctggttgtgcttcaatctcactttgaatgttaactctaa
accgctaacctgtttctttccctttattcactttttccacccaccattgcatgacatcag
GGTCAGTTTTGTGCATGACACCCGCTACCAGTATTG
gtaggtttcaaccttttttatttgtcttttatatgatgtacaataccttcacttgcttga
aatttatttcagagatggtagaaatgctataggaaatagtagatttgaaggcttatttgg
ctttagagttaacatataggtttttaaaaatgtacttgtatatttaagaaaatgacggtt
EXON 10  95 bp
ctattttcccttttttatttctctcccatgcttccttgctttgcattgtgattgcatgcc
atctgctggtttaacccatgatggcttgctgctctgatattcaccatgccaaaataccac
ttctattaccataatgctacaccctcctgttcattgctcccatggttcccctcctgaaag
TACCCATGATGCACAGCGCTACGTCCGCCACTGTCTCTGCAGCAACAACTCCTGCAACAA
GTGTCCCCTTCGCAGCAACAGCCACAGCCAATCAG
gtttgctccttttaaagctttctttcacaaatcccaaactctaaatgagtgctgatattt
aaaaaaaaaattctcggtgagaatttttttttcatgtttatccatcaaattttatttttt
taattagtttatagcaagcatttacagacaggttgcacttatttagagttaacatttact
EXON 11  679 bp
aagtgtaaagtttttcagcatgaagggcgggtattgtgcaaatttataattgcatcaaaa
taatgagagattgaagaaaactctgattttcaaatgtctatttttgaagagtaaaactta
aactcattatttttcctcccagaaggatacctaaatcatgcttgtctttctctttaacag
ATAATTCTGAAATAATCAGCAGAAACGGAATGGAATGCCAAGAATCTGCATTGAGAATAA
CTAAACATTGTTACTGTACATACTATCCTGTTTCCTCCTCAATAGAATTGCCACAAACTG
CATGCTAAATAAAGATGTAGTTCTTCTGGACAGACCACAACTCTAAGAAGCTAGTGCTGC
TATCTCATATATGAGTATTAAATATGGTATGCTTAGTATATTCCAACCTAAGATAGTTAA
CTACCTGAGACCAGCTGTGATGTTTAAAGACATAAAGGATAAAGTTTACTTTTAAAGGGT
TTCTAAACATAGTTTCTGTCCTAGGAATATTGTCTTATCTCCATAACTATAGCTGATGCA
GAAAGTCCAGCCAGTTTACTCATTTCGATTCAGAATATTTCAAATTTAGCAATAAACAAT
TAGCATTAGTTAAAAAAGAAACATATTCCAAGGGCAGGTTCGATTCTAGCTCTAATTACT
GTCATGTCATTTACCCACTGGATCAAAGGGTATGTTTCACTTCTTGACAATATAAATGCT
GCAGCAAAGATGAGAGGTGAAGTAAAACCGATACCTGTCCTGCAGGTCTAAAATTTGAAT
GGAAATTCAAGCACAAGTACTGGGGACACATCAAAGTGTGGTGTTTGGTTTGCCTGGAGA
TGCCACGTTGAATCATGTG
attctagattaacattaaatagattgaaaaagaaactttgcacggtatgagcttcatacc
ccaccaaacaaagtcttgaaggtattattttacaagtatatttttaaagttgttttataa
gagagactttgtagaagtgcctagattttgccagacttcatccagcttgacaagattgag