Gene IRS2 Variant 1
DNA : 3.97 KbNT_009952
mRNA : 3971 bp NM_003749
CDS : 3951 bp NP_003740
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  3971 bp
gcggtgctggcccccgcgggcctccccggaccttccccaccgcctgggcccgagggacgc
gtgatcgggcgggcggccgggcgcaagggtgggagggagccgcccccgcccgcgccccct
ccgcccctcgccccaacccctgggcgccgggcccgggccgcgcggcctgaagcgcccgcg
ATGGCGAGCCCGCCGCGGCACGGGCCGCCCGGGCCGGCGAGCGGAGACGGCCCCAACCTC
AACAACAACAACAACAACAACAACCACAGCGTGCGCAAGTGCGGCTACCTGCGCAAGCAG
AAGCATGGCCACAAGCGCTTCTTCGTGCTGCGCGGACCCGGCGCGGGCGGCGACGAGGCG
ACGGCGGGCGGGGGGTCGGCGCCGCAACCGCCGCGGCTCGAGTACTACGAGAGCGAGAAA
AAGTGGCGGAGCAAGGCAGGCGCGCCGAAACGGGTGATCGCTCTCGACTGCTGCCTGAAC
ATCAACAAGCGCGCCGACGCCAAGCACAAGTACCTGATCGCCCTCTACACCAAGGACGAG
TACTTCGCCGTGGCCGCCGAGAACGAGCAGGAGCAGGAGGGCTGGTACCGCGCGCTCACC
GACCTGGTCAGCGAGGGCCGCGCGGCCGCCGGAGACGCGCCCCCCGCCGCCGCGCCCGCC
GCGTCCTGCAGCGCCTCCCTGCCCGGCGCCCTGGGCGGCTCTGCCGGCGCCGCCGGGGCC
GAGGACAGCTACGGGCTGGTGGCTCCCGCCACGGCCGCCTACCGTGAGGTGTGGCAGGTG
AACCTGAAGCCCAAGGGTCTGGGCCAGAGCAAGAACCTGACGGGGGTGTACCGTCTGTGC
CTGTCTGCGCGCACCATCGGCTTCGTGAAGCTCAACTGCGAGCAGCCGTCGGTGACGCTG
CAGCTCATGAACATCCGCCGCTGCGGCCACTCGGACAGCTTCTTCTTCATCGAGGTGGGC
CGCTCGGCCGTCACAGGCCCCGGCGAGCTGTGGATGCAGGCGGACGACTCGGTGGTGGCG
CAGAACATCCACGAGACCATCCTGGAGGCCATGAAGGCGCTCAAGGAGCTCTTCGAGTTC
CGGCCGCGCAGTAAGAGCCAATCGTCGGGGTCGTCGGCCACGCACCCCATCAGCGTCCCC
GGCGCGCGCCGCCACCACCACCTGGTCAACCTGCCCCCCAGCCAGACGGGCCTGGTGCGC
CGCTCGCGCACCGACAGCCTGGCCGCCACCCCGCCGGCGGCCAAGTGCAGCTCGTGCCGG
GTGCGCACCGCCAGCGAGGGCGACGGCGGCGCGGCGGCGGGAGCGGCGGCCGCGGGCGCC
AGGCCGGTGTCGGTGGCTGGGAGCCCCCTGAGCCCCGGGCCGGTGCGCGCGCCCCTGAGC
CGCTCGCACACCCTGAGCGGCGGCTGCGGCGGCCGCGGGAGCAAGGTGGCGCTGCTGCCG
GCAGGGGGCGCGCTGCAACACAGCCGCTCCATGTCCATGCCCGTGGCGCACTCGCCGCCC
GCCGCCACCAGCCCCGGCTCCCTGTCGTCCAGCAGCGGCCACGGCTCGGGCTCCTACCCG
CCGCCGCCCGGCCCGCACCCGCCTCTGCCGCATCCGCTGCACCACGGCCCCGGCCAGCGG
CCCTCCAGCGGCAGCGCCTCCGCCTCGGGCTCCCCCAGCGACCCCGGCTTCATGTCCCTG
GACGAGTACGGCTCCAGCCCAGGCGACCTGCGCGCCTTCTGCAGCCACCGAAGCAACACG
CCCGAGTCCATCGCGGAGACGCCCCCGGCCCGAGACGGCGGCGGCGGCGGTGAGTTCTAC
GGGTACATGACCATGGACAGGCCCCTGAGCCACTGTGGCCGCTCCTACCGCCGGGTCTCG
GGGGACGCGGCCCAGGACCTGGACCGAGGGCTGCGCAAGAGGACCTACTCCCTGACCACG
CCAGCCCGGCAGCGGCCGGTGCCCCAGCCCTCCTCTGCCTCGCTGGATGAATACACCCTG
ATGCGGGCCACCTTCTCGGGCAGCGCGGGCCGCCTCTGCCCGTCCTGCCCCGCGTCCTCT
CCCAAGGTGGCCTACCACCCCTACCCAGAGGACTACGGAGACATCGAGATCGGCTCCCAC
AGGAGCTCCAGCAGCAACCTGGGGGCAGACGACGGCTACATGCCCATGACGCCCGGCGCG
GCCCTCGCGGGCAGTGGGAGCGGCAGCTGCAGGAGCGACGACTACATGCCCATGAGCCCC
GCCAGCGTGTCCGCCCCCAAGCAGATCTTGCAGCCCAGGGCCGCCGCCGCCGCCGCCGCC
GCCGTGCCTTCTGCGGGGCCTGCGGGGCCAGCACCCACCTCTGCGGCGGGCAGGACATTC
CCGGCGAGCGGGGGCGGCTACAAGGCCAGCTCGCCCGCCGAGAGCTCCCCCGAGGACAGT
GGGTACATGCGCATGTGGTGCGGTTCCAAGCTGTCCATGGAGCATGCAGATGGCAAGCTG
CTGCCCAACGGGGACTACCTCAACGTGTCCCCCAGCGACGCGGTCACCACGGGCACCCCG
CCCGACTTCTTCTCCGCAGCCCTGCACCCCGGCGGGGAGCCGCTCAGGGGCGTTCCCGGC
TGCTGCTACAGCTCCTTGCCCCGCTCCTACAAGGCCCCCTACACCTGTGGCGGGGACAGC
GACCAGTACGTGCTCATGAGCTCCCCCGTGGGGCGCATCCTGGAGGAGGAGCGTCTGGAG
CCTCAGGCCACGCCAGGGCCCAGCCAGGCGGCCAGCGCCTTCGGGGCCGGCCCCACGCAG
CCCCCTCACCCTGTAGTGCCTTCGCCCGTGCGGCCTAGCGGCGGCCGCCCGGAGGGCTTC
TTGGGCCAGCGCGGCCGGGCGGTGAGGCCCACGCGCCTGTCCCTGGAGGGGCTGCCCAGC
CTGCCCAGCATGCACGAGTACCCACTGCCACCGGAGCCCAAGAGCCCCGGCGAGTACATC
AACATCGACTTTGGCGAGCCCGGGGCCCGCCTGTCGCCGCCCGCGCCTCCCCTGCTGGCG
TCGGCGGCCTCGTCCTCCTCGCTCTTGTCCGCCAGCAGCCCGGCCTCGTCGCTGGGCTCA
GGCACCCCGGGCACCAGCAGCGACAGCCGGCAGCGGTCTCCGCTCTCCGACTACATGAAC
CTCGACTTCAGCTCCCCCAAGTCTCCTAAGCCGGGCGCCCCGAGCGGCCACCCCGTGGGC
TCCTTGGACGGCCTCCTGTCCCCCGAGGCCTCCTCCCCGTATCCGCCGTTGCCCCCGCGT
CCGTCCGCGTCCCCGTCGTCGTCTCTGCAGCCGCCGCCACCGCCGCCGGCCCCGGGGGAG
CTGTACCGCCTGCCCCCCGCCTCGGCCGTTGCCACCGCCCAGGGCCCGGGCGCCGCCTCA
TCGTTGTCCTCGGACACCGGGGACAATGGTGACTACACCGAGATGGCTTTTGGTGTGGCC
GCCACCCCGCCGCAACCTATCGCGGCCCCCCCGAAGCCAGAAGCTGCCCGCGTGGCCAGC
CCGACGTCGGGCGTGAAGAGGCTGAGCCTCATGGAGCAGGTGTCGGGAGTCGAGGCCTTC
CTGCAGGCCAGCCAGCCCCCGGACCCCCACCGCGGCGCCAAGGTCATCCGCGCAGACCCG
CAGGGGGGCCGCCGCCGCCACAGTTCCGAGACCTTCTCCTCCACCACGACGGTCACCCCC
GTGTCCCCGTCCTTCGCCCACAACCCCAAGCGCCACAACTCGGCCTCCGTGGAAAATGTC
TCTCTCAGGAAAAGCAGCGAGGGCGGCGTGGGTGTCGGCCCTGGAGGGGGCGACGAGCCG
CCCACCTCCCCACGACAGTTGCAGCCGGCGCCCCCTTTGGCACCGCAGGGCCGGCCGTGG
ACCCCGGGTCAGCCCGGGGGCTTGGTCGGTTGTCCTGGGAGCGGTGGATCGCCCATGCGC
AGAGAGACCTCTGCCGGCTTCCAGAATGGTCTCAACTACATCGCCATCGACGTGAGGGAG
GAGCCCGGGCTGCCACCCCAGCCGCAGCCGCCGCCGCCGCCGCTTCCTCAGCCGGGAGAC
AAGAGCTCCTGGGGCCGGACCCGAAGCCTCGGGGGTCTCATCAGCGCTGTGGGCGTCGGC
AGCACCGGCGGCGGGTGCGGGGGGCCGGGTCCCGGTGCCCTGCCCCCTGCCAACACCTAC
GCCAGCATTGA
cttcttgtcccaccacttgaaggaggccaccatcgtgaaaggtgaggaggccctttgcct
tggcgtctggcgggaaggaggggcggggcgctgagggagcctcttgggtttcactgctcc
cactttttggggaccttgacccagaagccgacagcctggcactggctccttgttttgttt