Gene IL17D Variant 1
DNA : 19.75 KbNT_024524
mRNA : 1860 bp NM_138284
CDS : 609 bp NP_612141
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  102 bp
gcgcgcgaccccaggccctgggcgccccgccgcatgctcgcggctggaagccccagtttg
cgtggcccttcgggttattccgctcaagagccgccgcgtcgccccatctcggcgcgaatc
tgaaagcgctttcgggggagaagatgttgggggcactggtgagtacactgcacaagtgac
AAAATGTTTTCAGCTCCTGGAGGCGAAAGGTGCAGAGTCGCTCTGTGTCCGTGAGGCCGG
GCGGCGACCTCGCTCAGTCGGCTTCTCGGTCCGAGTCCCCGG
gtacgaggaaagaccacagggggcttctcgcggaaaagcgggccgcggaccctgcgcggg
ctggctggggcgggcggatgacgaggcgcaggggcaagggtgggtctgcgaggcggcggg
tccgggcgtcttaggctccggggctccctcgctggcggcggagcagggatggcgcgcccg
EXON 2  296 bp
gcaggcggggagggcgctctggggcccgcccgcgcggctcccatcctccgggccggcctc
tggctccgcggggcgaggggaggcgcccgccggctccgggcgccgcgggcgggacacggg
cgcggggcgcaggcgggctcctccggcgcgtgcggacgctgagcgtggcctgtccctcag
GTCTGGATGCTGGTAGCCGGCTTCCTGCTGGCGCTGCCGCCGAGCTGGGCCGCGGGCGCC
CCGAGGGCGGGCAGGCGCCCCGCGCGGCCGCGGGGCTGCGCGGACCGGCCGGAGGAGCTA
CTGGAGCAGCTGTACGGGCGCCTGGCGGCCGGCGTGCTCAGTGCCTTCCACCACACGCTG
CAGCTGGGGCCGCGTGAGCAGGCGCGCAACGCGAGCTGCCCGGCAGGGGGCAGGCCCGCC
GACCGCCGCTTCCGGCCGCCCACCAACCTGCGCAGCGTGTCGCCCTGGGCCTACAG
gtgagccgcgggcgcgtcctggcggggcccggcaggtggggagggcagggctgggcgggg
agagtgggtggggccgggccgaggccgggcaggcggggagggtggggcggggaaggggag
gtggttggggcggggcgacgcggagggggcgtggcacgcggggcgaggcggagcaggtag
EXON 3  1462 bp
tttcaaatgtaaggaagcgccgggcagatctgttgtcggcggggggcctcgcacgcacgc
gcccgcaggcggaggacaggacagtccccgaggccctccccggtgactctaaccagggat
ttcagcgcgcggcgcggggctgcccccaggcgtgacctcacccgtgctctctccctgcag
AATCTCCTACGACCCGGCGAGGTACCCCAGGTACCTGCCTGAAGCCTACTGCCTGTGCCG
GGGCTGCCTGACCGGGCTGTTCGGCGAGGAGGACGTGCGCTTCCGCAGCGCCCCTGTCTA
CATGCCCACCGTCGTCCTGCGCCGCACCCCCGCCTGCGCCGGCGGCCGTTCCGTCTACAC
CGAGGCCTACGTCACCATCCCCGTGGGCTGCACCTGCGTCCCCGAGCCGGAGAAGGACGC
AGACAGCATCAACTCCAGCATCGACAAACAGGGCGCCAAGCTCCTGCTGGGCCCCAACGA
CGCGCCCGCTGGCCCCTGAGGCCGGTCCTGCCCCGGGAGGTCTCCCCGGCCCGCATCCCG
AGGCGCCCAAGCTGGAGCCGCCTGGAGGGCTCGGTCGGCGACCTCTGAAGAGAGTGCACC
GAGCAAACCAAGTGCCGGAGCACCAGCGCCGCCTTTCCATGGAGACTCGTAAGCAGCTTC
ATCTGACACGGGCATCCCTGGCTTGCTTTTAGCTACAAGCAAGCAGCGTGGCTGGAAGCT
GATGGGAAACGACCCGGCACGGGCATCCTGTGTGCGGCCCGCATGGAGGGTTTGGAAAAG
TTCACGGAGGCTCCCTGAGGAGCCTCTCAGATCGGCTGCTGCGGGTGCAGGGCGTGACTC
ACCGCTGGGTGCTTGCCAAAGAGATAGGGACGCATATGCTTTTTAAAGCAATCTAAAAAT
AATAATAAGTATAGCGACTATATACCTACTTTTAAAATCAACTGTTTTGAATAGAGGCAG
AGCTATTTTATATTATCAAATGAGAGCTACTCTGTTACATTTCTTAACATATAAACATCG
TTTTTTACTTCTTCTGGTAGAATTTTTTAAAGCATAATTGGAATCCTTGGATAAATTTTG
TAGCTGGTACACTCTGGCCTGGGTCTCTGAATTCAGCCTGTCACCGATGGCTGACTGATG
AAATGGACACGTCTCATCTGACCCACTCTTCCTTCCACTGAAGGTCTTCACGGGCCTCCA
GGTGGACCAAAGGGATGCACAGGCGGCTCGCATGCCCCAGGGCCAGCTAAGAGTTCCAAA
GATCTCAGATTTGGTTTTAGTCATGAATACATAAACAGTCTCAAACTCGCACAATTTTTT
CCCCCTTTTGAAAGCCACTGGGGCCAATTTGTGGTTAAGAGGTGGTGAGATAAGAAGTGG
AACGTGACATCTTTGCCAGTTGTCAGAAGAATCCAAGCAGGTATTGGCTTAGTTGTAAGG
GCTTTAGGATCAGGCTGAATATGAGGACAAAGTGGGCCACGTTAGCATCTGCAGAGATCA
ATCTGGAGGCTTCTGTTTCTGCATTCTGCCACGAGAGCTAGGTCCTTGATCTTTTCTTTA
GATTGAAAGTCTGTCTCTGAACACAATTATTTGTAAAAGTTAGTAGTTCTTTTTTAAATC
ATTAAAAGAGGCTTGCTGAAGG
atacactggctgtgtgtatttatctcaattctgcttgatgggccagactaattgttagag
gaaatcatatgttacctaaggtcttcactttatcttgaggtttaaattcatcgagatttg
atttggtcttagaaagatcaactagtcaggtaaggtcaatgtcttggatcttttgtgaca