Gene HS6ST3 Variant 1
DNA : 0.80 KbNT_009952
mRNA : 805 bp NM_153456
CDS : 711 bp NP_703157
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  805 bp
ggtacatacgtctttatggaaacatatgcacatgcatcaatagacacaaatgcaggcgaa
tactctcacatgaacatttggcaaagagtcccttgactcaatgccgatgtaaaattataa
aaatttagatacctcctgttagagttgtcaactactgatgctcttcctctaatttcttct
AGGAATTTCTATTACATCACAATGTTACGGGATCCAGTGTCACGTTACCTGAGCGAGTGG
AAACATGTCCAGAGAGGGGCCACTTGGAAAACCTCTCTTCATATGTGTGATGGAAGAAGC
CCCACCCCAGATGAGCTGCCTACCTGCTACCCTGGGGATGACTGGTCTGGGGTCAGCTTG
CGGGAGTTTATGGATTGCACCTACAACCTGGCTAACAATCGCCAGGTGCGCATGCTGGCT
GACCTCAGCCTGGTGGGCTGCTATAACTTGACTTTCATGAACGAGAGTGAAAGAAACACC
ATCCTGTTGCAGAGTGCAAAGAACAACCTGAAGAACATGGCCTTCTTTGGGCTCACTGAG
TTCCAGAGGAAGACACAGTTTCTCTTTGAGAGAACATTCAACCTCAAGTTCATCTCCCCC
TTCACACAGTTCAACATCACGCGGGCTTCTAACGTGGAGATCAACGAGGGTGCCCGCCAA
CGCATTGAGGATCTAAACTTCCTGGACATGCAGCTTTACGAGTATGCAAAAGATCTCTTC
CAGCAGCGCTACCACCACACCAAGCAGCTAGAGCACCAGAGGGACCGCCAGAAGCGGCGG
GAGGAGCGGAGGCTGCAGCGAGAGCACAGGGACCACCAGTGGCCCAAAGAAGATGGGGCT
GCAGAAGGGACTGTCACCGAGGACTACAACAGCCAGGTGGTGAGATGGTGACCTCCTGCC
CTCTCCTCTCTCAGGAGGGGGAGGGTGAGCAGGCACATTGACTTTCTGTTGAGGTACCTT
GGAGAAGCTGAGCCATTCTGAGGAC
atctggctgtgtgtgcttgatttggacatcttcttccttctttgtcttcatttttatcca
gctggagattatccgtcttgttcttttttttcttgacattttgcaattggtgatattaag
tagggtaggagtgcatcccatataggccattttagaaggccaaggagagccacaccgaaa