Gene FLT1 Variant 1
DNA : 193.44 KbNT_024524
mRNA : 5783 bp NM_002019
CDS : 4017 bp NP_002010
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  316 bp
cagggaagcgagcctgggaggaagaagagggtaggtggggaggcggatgaggggtggggg
accccttgacgtcaccagaaggaggtgccggggtaggaagtgggctggggaaaggttata
aatcgcccccgccctcggctgctcttcatcgaggtccgcgggaggctcggagcgcgccag
GCGGACACTCCTCTCGGCTCCTCCCCGGCAGCGGCGGCGGCTCGGAGCGGGCTCCGGGGC
TCGGGTGCAGCGGCCAGCGGGCGCCTGGCGGCGAGGATTACCCGGGGAAGTGGTTGTCTC
CTGGCTGGAGCCGCGAGACGGGCGCTCAGGGCGCGGGGCCGGCGGCGGCGAACGAGAGGA
CGGACTCTGGCGGCCGGGTCGTTGGCCGCGGGGAGCGCGGGCACCGGGCGAGCAGGCCGC
GTCGCGCTCACCATGGTCAGCTACTGGGACACCGGGGTCCTGCTGTGCGCGCTGCTCAGC
TGTCTGCTTCTCACAG
gtgaggcgcggctgggggccggggcctgaggcgggctgcgatggggcggccggagggcag
agcctccgaggccagggcggggtgcacgcggggagacgaggctgtagcccggagaagctg
gctacggcgagaacctgggacactagttgcagcgggcacgcttggggccgctgcgccctt
EXON 2  97 bp
aaaaatttgtgaattaagagaaatttgtattagtgtatcttttgcttataaattaaagat
acaagtaaattaaagatgtaaataaattaaaaatgaaaaactcaccttcatggaaagata
acttaaaaaaaggtaagaagacaatttacaaataatacattttaaaaatttgtttttcag
GATCTAGTTCAGGTTCAAAATTAAAAGATCCTGAACTGAGTTTAAAAGGCACCCAGCACA
TCATGCAAGCAGGCCAGACACTGCATCTCCAATGCAG
gtaagtggctgtgttggtttgggaataatctagttgccatgcctaaggcaaaatcattcc
ctggcagagtaaaaaggtagggacctcagtgatctcctgtgatctgcaaagtgcaaacca
taggcatccagcttcccatgaaaggggattcatggggaagggagagcattactcactcag
EXON 3  227 bp
tgcatctttattctgagtattgttctacagcttttctgaatgtgttgctttcccgtaaag
aggaagatgactacacttaagagaggacctccgcttcctaataaaatgaatgctgaggaa
ctggtgctgagcctagggcccagccataaatatgttttgttttcttatctgtgattgcag
GGGGGAAGCAGCCCATAAATGGTCTTTGCCTGAAATGGTGAGTAAGGAAAGCGAAAGGCT
GAGCATAACTAAATCTGCCTGTGGAAGAAATGGCAAACAATTCTGCAGTACTTTAACCTT
GAACACAGCTCAAGCAAACCACACTGGCTTCTACAGCTGCAAATATCTAGCTGTACCTAC
TTCAAAGAAGAAGGAAACAGAATCTGCAATCTATATATTTATTAGTG
gtaagacttccattttctacattctgtttgcttttgctttgcaaatgagtcataaatcta
ccctgatccattggaaaggttgctttcctagtgagtatgaaagaaacgggttaggaaaga
gattccatcctagttgtagacactttcgtggatgtcaattttaaccagaattgtcaaggc
EXON 4  125 bp
ctttttctgggtagaaacacagagggccaaattcagagacaaagatgtgaatgtatggat
tacattaagggagaatgacgtgactgtggcaatgcctaccataccacactagctacagtg
tctagatgcttgcatgtcaatcatttatgtatatatttttttcattttcttctcattcag
ATACAGGTAGACCTTTCGTAGAGATGTACAGTGAAATCCCCGAAATTATACACATGACTG
AAGGAAGGGAGCTCGTCATTCCCTGCCGGGTTACGTCACCTAACATCACTGTTACTTTAA
AAAAG
gtaaatttgaacaccgctattctcagcatactttcactgcaaataagcataatgaagttt
tactcgttctatctttctggaataatttccttacaaacacctgggcttctcagtggactt
tcctgtaacatccttttactataaggaatagtgctagaagttatgtccatgcatgtggtt
EXON 5  163 bp
aaaaactcaagaaccaattataacaaactagagtttttaacctagtttgttataagcaaa
ctacaaagttttactattttcattttagatgaaaaatcatgttttcacaaactgctggtg
aaacagtattgccaaccagtgctaataggaccttgttaatgcatgcctcttccttttcag
TTTCCACTTGACACTTTGATCCCTGATGGAAAACGCATAATCTGGGACAGTAGAAAGGGC
TTCATCATATCAAATGCAACGTACAAAGAAATAGGGCTTCTGACCTGTGAAGCAACAGTC
AATGGGCATTTGTATAAGACAAACTATCTCACACATCGACAAA
gtaagtgatgcttcaaaggcatgaacataagccgaagtgctctgtatttttatctgtgta
atgaaatcttaattttaaaaaatttctctcttatgcttgcagccaatacaatcatagatg
tccaaataagcacaccacgcccagtcaaattacttagaggccatactcttgtcctcaatt
EXON 6  137 bp
aagaaatagggcttctgacctgtgaagcaacagtcaatgggcatttgtataagacaaact
atctcacacatcgacaaagtaagtgatgcttcaaaggcatgaacataagccgaagtgctc
tgtatttttatctgtgtaatgaaatcttaattttaaaaaatttctctcttatgcttgcag
CCAATACAATCATAGATGTCCAAATAAGCACACCACGCCCAGTCAAATTACTTAGAGGCC
ATACTCTTGTCCTCAATTGTACTGCTACCACTCCCTTGAACACGAGAGTTCAAATGACCT
GGAGTTACCCTGATGAA
gtgagtgacccatttttctatttcttctgcaggacagtattttaagcaagtgaaatcccg
caggggttttgagatgggaaaaatcagaaaatcctgactcctgtggcagtgttagtcaat
aaagaagctttgggtttggtttgagtgctttctttgcctggcatttcatgagtgtgatat
EXON 7  175 bp
tgaagcacctctagacacagatgtagtttccaaacattacgctctaggtggatttgacat
gattcttagtataaaacagaagctgttgtcgaactaatgatctaagaaatgttaaaatcc
tatataactttaagcatgaacactcactccttctacatttgttatacattttctttctag
AAAAATAAGAGAGCTTCCGTAAGGCGACGAATTGACCAAAGCAATTCCCATGCCAACATA
TTCTACAGTGTTCTTACTATTGACAAAATGCAGAACAAAGACAAAGGACTTTATACTTGT
CGTGTAAGGAGTGGACCATCATTCAAATCTGTTAACACCTCAGTGCATATATATG
gtaagcatagttcagcgttgccaactcatgctatgctttctaatcattgtagatgtctgt
gttctctaaataagtcagttttctgttggccaagagttacattatcatgaatgaatacag
cttggccatggttccctcctccccctgtcaaaaagcaaaccacattaagtactctttaca
EXON 8  118 bp
ccaattacagtgcttttaaagtatcctattcatgatcaacatttgggctcattgataggc
tctatcataattcagctctgtttatttactcattgattacaccctccctgaatgaggccc
taaggttttgtttatggaaattattcttttctaatgtatgtatcacttctcctttcaaag
ATAAAGCATTCATCACTGTGAAACATCGAAAACAGCAGGTGCTTGAAACCGTAGCTGGCA
AGCGGTCTTACCGGCTCTCTATGAAAGTGAAGGCATTTCCCTCGCCGGAAGTTGTATG
gtaggaccatccttatttccataacagtttaagacatactttgtaagtgggaagctgcaa
gagcctaatgactcgaattcctgacaaaataccaagagacgttcctcagacagccccaga
gagctcagaactctgtagattcttgggtggtggaggtgagaagggctggggaaaaggaaa
EXON 9  170 bp
ccagtctaaaaatcatatctgcctttactcaaaagttaatgcctacattttaaaaatcaa
cactgatgatcaaaggtttgaaattggtcaacttgagctcaaaaacttcaatgaccgtgt
tatcaaagtgatattgagaggccgtgtgaaatgacttactgatcatgtttttaaccacag
GTTAAAAGATGGGTTACCTGCGACTGAGAAATCTGCTCGCTATTTGACTCGTGGCTACTC
GTTAATTATCAAGGACGTAACTGAAGAGGATGCAGGGAATTATACAATCTTGCTGAGCAT
AAAACAGTCAAATGTGTTTAAAAACCTCACTGCCACTCTAATTGTCAATG
gtaagtttgctgttcatactttcttctggttctggtaggcaacaaattagtgaacattta
tgaattcaaaaatcagcgtaacaacatcaaagatagcaaaatttcaaataatcatttgaa
aaaacacttaacgttaagttcccatcttaacaatctcgtgtttgtttgttgtattccata
EXON 10  160 bp
ctgctactacttttaaaaatctgcattttcttgacaaataggagggtttatttgtttttt
tgtttcttgtttgtttccctgacatcaaagccagtgagaatgtggtccttcatgtgtggc
ccaggagaaagtcattagaactgctcttgacttctgtcccgttcttcatctcctttccag
TGAAACCCCAGATTTACGAAAAGGCCGTGTCATCGTTTCCAGACCCGGCTCTCTACCCAC
TGGGCAGCAGACAAATCCTGACTTGTACCGCATATGGTATCCCTCAACCTACAATCAAGT
GGTTCTGGCACCCCTGTAACCATAATCATTCCGAAGCAAG
gtagggacagtcagtttttttactaactttcaaatactttttgacacctggaattaagat
tttttaatggacgcagatgggaatctgcatgtgggatgtactgtatatttgaggcaaagg
ctctccctgccttggaaaaaggtgggcaacagctactcttctttcttactgaatataccc
EXON 11  115 bp
atatatttgctatttttaagttttgaggatgaatataggaaaaaatctaaggaaaagaag
atcacacataaaatttgtgactttgttatctgaggacttacaccaagttttcatttcacc
tgtccccattgactgaaccatgctgtaaagccacattgtgacaacttttttttttaatag
GTGTGACTTTTGTTCCAATAATGAAGAGTCCTTTATCCTGGATGCTGACAGCAACATGGG
AAACAGAATTGAGAGCATCACTCAGCGCATGGCAATAATAGAAGGAAAGAATAAG
gtattgtttgtaaaaatgcgcactgggatatttattccacaaatacactctcagctccca
attctaggtttattggcaccagaagtaatttaaatgttcaaacaaaaattcagagagaag
aaagacaatatctgagctatgtcttcatggagatacacacagagactactcaagctacca
EXON 12  109 bp
ttatttttccattcttgttggggctcggcaaggggagagccttctggtaaccaccaccta
tgcaatactctctttgcagaatgaatggagtagctgaatcatttcaacctcagaagtagc
ttggggtgttcaattagttatttgtcctgttgctagctaaagtttccttttcttttgcag
ATGGCTAGCACCTTGGTTGTGGCTGACTCTAGAATTTCTGGAATCTACATTTGCATAGCT
TCCAATAAAGTTGGGACTGTGGGAAGAAACATAAGCTTTTATATCACAG
gtaagccacacatcctataaccagagacagcctggtgacttcattctctcttcagtcttg
tttgcttttagtgcatttatagcttgagtgatttttttttaattccatagaattgtcaaa
ctttgagtgccttcatccttgctctcaggaatagaattctacctcatcggatctcgtaag
EXON 13  309 bp
tgatggaatgaacttagttgattcccacctgctgtgtttgctcatttaccccaaatactc
atcctttttaatgtggatactgagataatttgtgcacgaacaattcttaagatctttgaa
tatctcattaaaagacactgatttttctgtgaactgaagttctttattcttattttatag
ATGTGCCAAATGGGTTTCATGTTAACTTGGAAAAAATGCCGACGGAAGGAGAGGACCTGA
AACTGTCTTGCACAGTTAACAAGTTCTTATACAGAGACGTTACTTGGATTTTACTGCGGA
CAGTTAATAACAGAACAATGCACTACAGTATTAGCAAGCAAAAAATGGCCATCACTAAGG
AGCACTCCATCACTCTTAATCTTACCATCATGAATGTTTCCCTGCAAGATTCAGGCACCT
ATGCCTGCAGAGCCAGGAATGTATACACAGGGGAAGAAATCCTCCAGAAGAAAGAAATTA
CAATCAGAG
gtgagcactgcaacaaaaaggctgttttctctcggatctccaaatttaaaagcacaagga
atgattgtaccacacaaagtaatgtaaaacattaaaggactcattaaaaagtaacagttg
tctcatatcatcttgatttattgtcactgttgctaactttcaggctcggaggagatgctc
EXON 14  147 bp
tcgtagcatcttattaaagtagaagcagcaggttaatgattgaagagaaagtgaacaaat
gaaaatgaaacctaatagttgagttttgctgtttctctgtatattttaaatgttgatatg
catagacaatacaagaataaagttgacgagtaatcacagctccctttctttcttcactag
ATCAGGAAGCACCATACCTCCTGCGAAACCTCAGTGATCACACAGTGGCCATCAGCAGTT
CCACCACTTTAGACTGTCATGCTAATGGTGTCCCCGAGCCTCAGATCACTTGGTTTAAAA
ACAACCACAAAATACAACAAGAGCCTG
gtaagagacttttttttcttccatttattatttctcatctttcatcagcccccctttccc
ttaacagtcccgtcacctgcttccagtatgtatagacctacttgctgatagagccccaaa
cactgggatctggttcatgctgatagcaatgtccagtgaggaatatttgggccagttcct
EXON 15  132 bp
aagaaaagaaaaagaaagcctggacccagagaaaacaaataagcaaccctgccccaggtt
cactagagctcggatttccttgtctgaatgcataatgataggaagaaggctgtgttacag
aagtagctgttttttgtttgtcatccaggcccactaatctaaacatctctcacccctcag
GAATTATTTTAGGACCAGGAAGCAGCACGCTGTTTATTGAAAGAGTCACAGAAGAGGATG
AAGGTGTCTATCACTGCAAAGCCACCAACCAGAAGGGCTCTGTGGAAAGTTCAGCATACC
TCACTGTTCAAG
gtaaacagctgcttaagaaagcaacaagaaattggtcagacatctatttccctgtttgtt
taactttccacctcccagtctcctgctgcctgctccagtctgttcctttccctgacctcc
ttctcccctctccctgccactccgggaagggactgtctggttctgtctggcaaagcagaa
EXON 16  107 bp
catgtatactgcctggcttagaaggtaagagatctgtcccagagactgattttgtggcag
cagattgggttcgctatgataaaccatttagggaaactgagcctcttttataaaaccaca
aagattctgagtttgggaatttctttgttgcaccactattgtgattttttttctctccag
GAACCTCGGACAAGTCTAATCTGGAGCTGATCACTCTAACATGCACCTGTGTGGCTGCGA
CTCTCTTCTGGCTCCTATTAACCCTCTTTATCCGAAAAATGAAAAGG
gtaagaacataggtgatgttctatgctcctttttacatatattctaaaaagcccgatctg
atgtctagagtaggcaaacaaatgttggaccctctttctttcccttccctctcattccta
tctctgacctggtgaacacagaaagaaaataaatcatcaaaatgtctctagccacaaggg
EXON 17  133 bp
ttaatagaaattgcacacctaagtgtgatgagtgtatgtgaatgtggagaagtactttct
gcacctggccacacagtttcaaccaaatgatcccaaataaaacagtggatgttaacggaa
tatctaggatttgtaaagttgttttcttctcgatgactttgagatctctttatttctcag
TCTTCTTCTGAAATAAAGACTGACTACCTATCAATTATAATGGACCCAGATGAAGTTCCT
TTGGATGAGCAGTGTGAGCGGCTCCCTTATGATGCCAGCAAGTGGGAGTTTGCCCGGGAG
AGACTTAAACTGG
gtaagatatttgttcaacagattcataaacctatactgagcacatattacatgaaaaaca
ctgtgctttgagagatgcgaaagtaaactagacctgggattctaccctccagctgctcac
agactagcaagggagatggacacaaaagtaaataattccaatgcaatgctcagataacag
EXON 18  105 bp
ttaagagttgaaaggaagagactccagaaataagtcccttactttgtctcttttagggtt
agttcactggagattccatgcctcacatgcacacataggaaaaggcatttccttcctgaa
aaagacttaaactcaccctattgcctcggcaaacaaaccagtgtcttctcttcattacag
GCAAATCACTTGGAAGAGGGGCTTTTGGAAAAGTGGTTCAAGCATCAGCATTTGGCATTA
AGAAATCACCTACGTGCCGGACTGTGGCTGTGAAAATGCTGAAAG
gtatgtatgctgtagtttggctttcaactgacccatcaccattttgcatttcctaaatgt
tggtacaagttagatatagcctgggaacagacacaagcttttctgctctggacacataat
tttcttctactgctagaggcctctttgctcacgagttttagattaggccagcacgagctc
EXON 19  114 bp
gttggctcaggagggtgggagtaatgaaaacagtctggagacttggcctttctgcagaat
gtggggaagttagtgaagcaaccggctgagcattgacaaacaaggagggcaagaatgccg
cctccggcggaaggagccccattgtcctgtcgccctgactcttccttgcttctcacacag
AGGGGGCCACGGCCAGCGAGTACAAAGCTCTGATGACTGAGCTAAAAATCTTGACCCACA
TTGGCCACCATCTGAACGTGGTTAACCTGCTGGGAGCCTGCACCAAGCAAGGAG
gtaatggagaaggggagggccggctccgtctccccctgcacaggctgggagaacagttct
ctgccttacagctccttctcccccgcactgtgcttcctcgcctccaggaaaacggcctcc
ctaatagctctagaagaaacagcttgtgcatctacagaagggtgctcccataaatccctt
EXON 20  89 bp
cttcttaggttaaactgaaaaagtcaccgtattcatgggcctctcatccctaaatcgcat
cccttcgccccactaatacaaaggctggttggtttgaggtttctcaggcaggctgaaggc
tggcaaatggctgactggcttggtgtggctgagcatgagcatgtgctgttttggctgcag
GGCCTCTGATGGTGATTGTTGAATACTGCAAATATGGAAATCTCTCCAACTACCTCAAGA
GCAAACGTGACTTATTTTTTCTCAACAAG
gtaaggatttcaaaagttggaggtttttaaagatagcaatgagttttcatttagtctgta
acaacataaagcaagagaaacctgtattgtgttgttaatgattaaacttaaaactcaatc
tctgcttcttctccttttttcatgttttttcccctgataatctgttacactctagtgtgg
EXON 21  157 bp
tctgcaactccagaggtagtcaggctcctggacaccgtagggcccctgtgctagttcacg
atccattttgagaagtgaaacgctctcatttctcatcaggcgattgccagttgagggact
ggtttcccactgctgtgctggagctccttttcacctgggtccttttcggtctcttcaaag
GATGCAGCACTACACATGGAGCCTAAGAAAGAAAAAATGGAGCCAGGCCTGGAACAAGGC
AAGAAACCAAGACTAGATAGCGTCACCAGCAGCGAAAGCTTTGCGAGCTCCGGCTTTCAG
GAAGATAAAAGTCTGAGTGATGTTGAGGAAGAGGAGG
gtaggtattaattccttcctgtcctacgcgctgagatatttttacaacatactatgcatc
tctgaaatttttttcttatttatcactctaataaacatccgtgggagactcgaatggtaa
tgtcctgaggagataagatttgaattaagataatttacagagttactaattttgacaggg
EXON 22  98 bp
aagtgggctggaggcctggaaaaatctctggtgttcatgttgaaactcaaatactcttaa
aaatgaactctgatctacttgttggtttgttttatgttttgctaacattgttccaataaa
ctgggatttggtgggataacaagagccattacaaacagttacggttctaatgctttccag
ATTCTGACGGTTTCTACAAGGAGCCCATCACTATGGAAGATCTGATTTCTTACAGTTTTC
AAGTGGCCAGAGGCATGGAGTTCCTGTCTTCCAGAAAG
gtcagtcttgctgtttactgtttttcttctctgccagggctggacacacacctttgctat
aaattcatttttcctagtatttgctgatacctatgttcttaaatgtagaacaaacaccac
tgcaagtgccttaatttgccttgatatgaggagttttgagaatgaggagtcatggatacc
EXON 23  123 bp
tggggacctgtatttgtagagaggctcttcatgtttatggtaactctgtgtgcaccgaga
ggtgctcccttcacagcatgtgaaatggattcccaaattaagataatgacactgacaggt
gtaggaaattagttggttaggttaaggaaatgcattgattatgcaactgttttattatag
TGCATTCATCGGGACCTGGCAGCGAGAAACATTCTTTTATCTGAGAACAACGTGGTGAAG
ATTTGTGATTTTGGCCTTGCCCGGGATATTTATAAGAACCCCGATTATGTGAGAAAAGGA
GAT
gtaagtcagtttgatgtttatttgactcatgtgtgtcctatcacttttaaaccacagact
tggtaaatatttacacttcctcagctgtagtccctgaaaaccatcattggctttctgtga
agacaaacagtccagatgagcggcatcccagagagcccttgtgtaaggctcagaaaggcc
EXON 24  112 bp
tagctccctcttttagcgtaacactgcatactatggtgttctctatgttaggaaaccaga
gctgctctcggaaatgatttataggccgtatgttatctgggaggtgaccccatggacact
cgggttgaatgtgctttgttttcatgcccttctgctcaaggcccccttgccctcttctag
ACTCGACTTCCTCTGAAATGGATGGCTCCTGAATCTATCTTTGACAAAATCTACAGCACC
AAGAGCGACGTGTGGTCTTACGGAGTATTGCTGTGGGAAATCTTCTCCTTAG
gtaaatttgggagaaggaagaaatcaaacagcccagaaataaatgtctgcatcttctgct
gaatgtcctttggttagacagcctttagattagaacctactgtaacaaaaaactcttaaa
gtgtaatgggcccatgtagactctcagatgagtaatggcgtacgcatgtctgccctctac
EXON 25  100 bp
caaggatttgctgagcttctctgtgtgttgtacggtatgttgagatctgttgtaatccct
gggaatttattactaaaacgtagctttaaagggaggaaagaaacactgaattgtcccctc
ttggtcttttgtacccttaagccataacaggccctgtgttttccacattgtctcccgcag
GTGGGTCTCCATACCCAGGAGTACAAATGGATGAGGACTTTTGCAGTCGCCTGAGGGAAG
GCATGAGGATGAGAGCTCCTGAGTACTCTACTCCTGAAAT
gtgagcccttggtgccctctgctccccatctgacagctcgcttttcaccagggcattcct
gagaggggatgttttatggattcttagagtcccagtcttggaagatgccaaggttcttct
ttcctttagagatgctcccctcagcccatcaggcccagatatgctgggagtgttttcttg
EXON 26  106 bp
cccagacagccttttaagtgctggtgctataaacccaaacctaaaaatgaagcagggtca
catagtacagaaagcttgggctttatgcggatgatgacagccctccctttgtagtacgta
aggcaatgcataggatgatcactgctctccaactatttctgttgctgttttccccaccag
CTATCAGATCATGCTGGACTGCTGGCACAGAGACCCAAAAGAAAGGCCAAGATTTGCAGA
ACTTGTGGAAAAACTAGGTGATTTGCTTCAAGCAAATGTACAACAG
gtaaaactaaatttatttacatcaaaatgcctttgaatgtacgtcaggggggcattttat
ttgttttttttttaagagctattaatataatagctgagatcagaagtttaaaaaaagggt
gtgtgtgtgtgtatacagaattatcttctcaaaacacaaccaagattgtgcaaatgacat
EXON 27  143 bp
attaatataatagctgagatcagaagtttaaaaaaagggtgtgtgtgtgtgtatacagaa
ttatcttctcaaaacacaaccaagattgtgcaaatgacatagtcaaagttgacataatgg
ttcatagaaattgttgaagtcagaattggtgcaacgagagctctacctttggtattttag
GATGGTAAAGACTACATCCCAATCAATGCCATACTGACAGGAAATAGTGGGTTTACATAC
TCAACTCCTGCCTTCTCTGAGGACTTCTTCAAGGAAAGTATTTCAGCTCCGAAGTTTAAT
TCAGGAAGCTCTGATGATGTCAG
gtaagatttctttctcaaactttatatcacagaattttccaacaaaaaaaagaaggaaag
aaagacgaaagagaaagaaagacgaaagagagaaagaaagagagaaagaaagaaagagag
aaagaaagaaagaaagattatgttgatcaccacccatatgcccatcccctaaattcaact
EXON 28  85 bp
cagtggcaatgctgtcaggattcccaggggtcacggcggggagatcggggcctcaggagt
taggtgattcctgttggtgtgttggttcatcttagctgggatatggtgcctgtggtctcc
tgactcattagagctggatgccttttcctgtcttgataattctttctgtttcttcattag
ATACGTAAATGCTTTCAAGTTCATGAGCCTGGAAAGAATCAAAACCTTTGAAGAACTTTT
ACCGAATGCCACCTCCATGTTTGAT
gtaagtcgtgaagttaaggtacctagtgcaccccgatagaccccttcttcagatcccttc
caaacaccaacgccagtaatgtagtagttcttggtcagtgagggtctggattcaggagtg
gctgaaatgacagtgtggggaggactgacaactagacctagctgtgcagaactaatttga
EXON 29  95 bp
tttgcagcgggtcaagtttgtagtggccaacttagagaaatgctttgtctcaataggctg
ggattgtggagggtgaggcagagcctggatcaacagatgtatcccaggatcatccctcag
gctcagcatggacccccgctgggccaggcaagagtataacctttctccttctccccctag
GACTACCAGGGCGACAGCAGCACTCTGTTGGCCTCTCCCATGCTGAAGCGCTTCACCTGG
ACTGACAGCAAACCCAAGGCCTCGCTCAAGATTGA
gtaagaattgggtatcttttctgtgatcagttgatggaggggtacgaggggagatgctgg
gggaaggtggtataatgagggatgtttgaggactacttgccctcctgaactgtggtatcc
gggagttgcagaaaaccatttccccccagagggcaaaaaaaggggaacatcaaacgggac
EXON 30  1716 bp
aggccgtgtgcagctttagaacagaggaaatctgacagcaattgagggggggggggttcc
aaaaccatgaactctagacaggtatgaacaaatgacccactcagaaagagtagattttag
tgtctttgttttctaaaaaaccaattttgaatatttgatttctttcctttctttctttag
CTTGAGAGTAACCAGTAAAAGTAAGGAGTCGGGGCTGTCTGATGTCAGCAGGCCCAGTTT
CTGCCATTCCAGCTGTGGGCACGTCAGCGAAGGCAAGCGCAGGTTCACCTACGACCACGC
TGAGCTGGAAAGGAAAATCGCGTGCTGCTCCCCGCCCCCAGACTACAACTCGGTGGTCCT
GTACTCCACCCCACCCATCTAGAGTTTGACACGAAGCCTTATTTCTAGAAGCACATGTGT
ATTTATACCCCCAGGAAACTAGCTTTTGCCAGTATTATGCATATATAAGTTTACACCTTT
ATCTTTCCATGGGAGCCAGCTGCTTTTTGTGATTTTTTTAATAGTGCTTTTTTTTTTTTG
ACTAACAAGAATGTAACTCCAGATAGAGAAATAGTGACAAGTGAAGAACACTACTGCTAA
ATCCTCATGTTACTCAGTGTTAGAGAAATCCTTCCTAAACCCAATGACTTCCCTGCTCCA
ACCCCCGCCACCTCAGGGCACGCAGGACCAGTTTGATTGAGGAGCTGCACTGATCACCCA
ATGCATCACGTACCCCACTGGGCCAGCCCTGCAGCCCAAAACCCAGGGCAACAAGCCCGT
TAGCCCCAGGGATCACTGGCTGGCCTGAGCAACATCTCGGGAGTCCTCTAGCAGGCCTAA
GACATGTGAGGAGGAAAAGGAAAAAAAGCAAAAAGCAAGGGAGAAAAGAGAAACCGGGAG
AAGGCATGAGAAAGAATTTGAGACGCACCATGTGGGCACGGAGGGGGACGGGGCTCAGCA
ATGCCATTTCAGTGGCTTCCCAGCTCTGACCCTTCTACATTTGAGGGCCCAGCCAGGAGC
AGATGGACAGCGATGAGGGGACATTTTCTGGATTCTGGGAGGCAAGAAAAGGACAAATAT
CTTTTTTGGAACTAAAGCAAATTTTAGAACTTTACCTATGGAAGTGGTTCTATGTCCATT
CTCATTCGTGGCATGTTTTGATTTGTAGCACTGAGGGTGGCACTCAACTCTGAGCCCATA
CTTTTGGCTCCTCTAGTAAGATGCACTGAAAACTTAGCCAGAGTTAGGTTGTCTCCAGGC
CATGATGGCCTTACACTGAAAATGTCACATTCTATTTTGGGTATTAATATATAGTCCAGA
CACTTAACTCAATTTCTTGGTATTATTCTGTTTTGCACAGTTAGTTGTGAAAGAAAGCTG
AGAAGAATGAAAATGCAGTCCTGAGGAGAGGAGTTTTCTCCATATCAAAACGAGGGCTGA
TGGAGGAAAAAGGTCAATAAGGTCAAGGGAAAACCCCGTCTCTATACCAACCAAACCAAT
TCACCAACACAGTTGGGACCCAAAACACAGGAAGTCAGTCACGTTTCCTTTTCATTTAAT
GGGGATTCCACTATCTCACACTAATCTGAAAGGATGTGGAAGAGCATTAGCTGGCGCATA
TTAAGCACTTTAAGCTCCTTGAGTAAAAAGGTGGTATGTAATTTATGCAAGGTATTTCTC
CAGTTGGGACTCAGGATATTAGTTAATGAGCCATCACTAGAAGAAAAGCCCATTTTCAAC
TGCTTTGAAACTTGCCTGGGGTCTGAGCATGATGGGAATAGGGAGACAGGGTAGGAAAGG
GCGCCTACTCTTCAGGGTCTAAAGATCAAGTGGGCCTTGGATCGCTAAGCTGGCTCTGTT
TGATGCTATTTATGCAAGTTAGGGTCTATGTATTTA
tgatgtctgcaccttctgcagccagtcagaagctggagaggcaacagtggattgctgctt
cttggggagaagagtatgcttccttttatccatgtaatttaactgtagaacctgagctct
aagtaaccgaagaatgtatgcctctgttcttatgtgccacatccttgtttaaaggctctc