Gene FGF14 Variant 2
DNA : 152.61 KbNT_009952
mRNA : 698 bp NM_175929
CDS : 552 bp NP_787125
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  112 bp
ctttaccttctataaatagaatactgcaggtttgataaaacacagaagaatctgagagac
aaaataaaatatgctacttgtataaaatgtcctcttctgaaaaaagaaagagaaacagaa
aagataaaggaaactatggtgacacattgtgaggcttatgataactatgtttgcctttca
GATCCCCAGCTCAAGGGTATAGTGACCAGGTTATATTGCAGGCAAGGCTACTACTTGCAA
ATGCACCCCGATGGAGCTCTCGATGGAACCAAGGATGACAGCACTAATTCTA
gtaagtgacaacctcaggccaccagttacatagttggtagaagatacactgctacttaaa
tgactttttaagattcatttgcaaatgtttggtcgtgttggttcatctttacaaatgtta
cacactaggatgccatttacaattttatttaaactacgtggatgaaaatattaatggagt
EXON 2  104 bp
tcattttacccatagcagaaacttcttacttataaagcaaaatataagttatttaattgg
aatttctagaaagtattggcaaagatgatgtttcttaaataaaataaatcagaaagaaaa
aattacactctgccctgcttcttcctgcccattcatgatagacaatgtttatcttcacag
CACTCTTCAACCTCATACCAGTGGGACTACGTGTTGTTGCCATCCAGGGAGTGAAAACAG
GGTTGTATATAGCCATGAATGGAGAAGGTTACCTCTACCCATCA
gtaagtaagacgccaaagatctcggccattcgttcaatgcatgtaaaataacaatggcag
caacaacaaaaagaaagttctatgtctgttgtttctgccagtttttgccttagtatttga
tctttgcgagaatgcttagaagctgtttattattcaccagtgtttagtaatatgagttta
EXON 3  199 bp
ctcaatttattgtatattttaaaaatgtatagacaattactgtgcgcaggaaggggtata
tccggtcctccatgccaaagcactctttcaccatgctgggaaactttctagagaatgagt
agaatgtacagtgaagatcaagttccttcctctaacttttgtttcattttctctccacag
GAACTTTTTACCCCTGAATGCAAGTTTAAAGAATCTGTTTTTGAAAATTATTATGTAATC
TACTCATCCATGTTGTACAGACAACAGGAATCTGGTAGAGCCTGGTTTTTGGGATTAAAT
AAGGAAGGGCAAGCTATGAAAGGGAACAGAGTAAAGAAAACCAAACCAGCAGCTCATTTT
CTACCCAAGCCATTGGAAG
gtgagtattatgcatgcattattattacatagacttattacatattttatttttcaaatt
gataggtctaccatggctctaagaaaccttcacaaagtgctggaaatgtcatttattttg
atctaggtgatggttgcacaggtgcctacttaagttattgatttagaatttgtgcccctt
EXON 4  283 bp
atgtcctctgtgggctggaaatgattgctttacaacaggaattctgtctcaatggaattg
ctttacttcagggaaaacagaaatgggcaaactgcagtggtctatgcaggtatggatgga
ccattctcacacctaaccaagcaatgtttgcttttcctcctcctttcttcccatcactag
TTGCCATGTACCGAGAACCATCTTTGCATGATGTTGGGGAAACGGTCCCGAAGCCTGGGG
TGACGCCAAGTAAAAGCACAAGTGCGTCTGCAATAATGAATGGAGGCAAACCAGTCAACA
AGAGTAAGACAACATAGCCAGATCCTCACAGGTGTTGTGACTTATTCGTCCTGAGCACAG
TTGAGTGATTTATCCTCACCAGACATTCCTGCTCCGTGGCTGAAGAGCAGCAGGAAGTAA
GCTAATGCTTATTCTTTGCTGTCTCCGAACTTCTCTGTTGCAA
gtggataaatctcaacctgttgcaccccccacaacaagaagacacctggataaccagcta
aactcagaccatggaatgccctaccagatatggaatgcctttttaatatcttttctgtga
ctgtgacacttcatgtgaatgacatacttcacaagtacactcgataccttgcctgctgac