Gene FGF14 Variant 1
DNA : 193.96 KbNT_009952
mRNA : 890 bp NM_004115
CDS : 0 bp
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  193 bp
ggagagggcgatgggtcccggtcaggactgagccccccttcccctctccccagtcccgcc
tggcaccccctcctctgccccgagggcgagccacggtctgcgccgccgccttcccctccg
gtgcccccggctcgccgtcctcccgcgccctccctccccggacccgttcccggggccacc
ATGGCCGCGGCCATCGCTAGCGGCTTGATCCGCCAGAAGCGGCAGGCGCGGGAGCAGCAC
TGGGACCGGCCGTCTGCCAGCAGGAGGCGGAGCAGCCCCAGCAAGAACCGCGGGCTCTGC
AACGGCAACCTGGTGGATATCTTCTCCAAAGTGCGCATCTTCGGCCTCAAGAAGCGCAGG
TTGCGGCGCCAAG
gtctgtgggggtcatggtcgggagatgcgccccgggtcgccccctccccgcctaaacgga
gcttctccaggctccttccctccctcggttttcccggcccaccccggccccggcctccct
tctgagcactctgggtgccgtcgcggggaccctggagtccgctgtcgggcaacctgtagc
EXON 2  111 bp
tttaccttctataaatagaatactgcaggtttgataaaacacagaagaatctgagagaca
aaataaaatatgctacttgtataaaatgtcctcttctgaaaaaagaaagagaaacagaaa
agataaaggaaactatggtgacacattgtgaggcttatgataactatgtttgcctttcag
ATCCCCAGCTCAAGGGTATAGTGACCAGGTTATATTGCAGGCAAGGCTACTACTTGCAAA
TGCACCCCGATGGAGCTCTCGATGGAACCAAGGATGACAGCACTAATTCTA
gtaagtgacaacctcaggccaccagttacatagttggtagaagatacactgctacttaaa
tgactttttaagattcatttgcaaatgtttggtcgtgttggttcatctttacaaatgtta
cacactaggatgccatttacaattttatttaaactacgtggatgaaaatattaatggagt
EXON 3  104 bp
tcattttacccatagcagaaacttcttacttataaagcaaaatataagttatttaattgg
aatttctagaaagtattggcaaagatgatgtttcttaaataaaataaatcagaaagaaaa
aattacactctgccctgcttcttcctgcccattcatgatagacaatgtttatcttcacag
CACTCTTCAACCTCATACCAGTGGGACTACGTGTTGTTGCCATCCAGGGAGTGAAAACAG
GGTTGTATATAGCCATGAATGGAGAAGGTTACCTCTACCCATCA
gtaagtaagacgccaaagatctcggccattcgttcaatgcatgtaaaataacaatggcag
caacaacaaaaagaaagttctatgtctgttgtttctgccagtttttgccttagtatttga
tctttgcgagaatgcttagaagctgtttattattcaccagtgtttagtaatatgagttta
EXON 4  199 bp
ctcaatttattgtatattttaaaaatgtatagacaattactgtgcgcaggaaggggtata
tccggtcctccatgccaaagcactctttcaccatgctgggaaactttctagagaatgagt
agaatgtacagtgaagatcaagttccttcctctaacttttgtttcattttctctccacag
GAACTTTTTACCCCTGAATGCAAGTTTAAAGAATCTGTTTTTGAAAATTATTATGTAATC
TACTCATCCATGTTGTACAGACAACAGGAATCTGGTAGAGCCTGGTTTTTGGGATTAAAT
AAGGAAGGGCAAGCTATGAAAGGGAACAGAGTAAAGAAAACCAAACCAGCAGCTCATTTT
CTACCCAAGCCATTGGAAG
gtgagtattatgcatgcattattattacatagacttattacatattttatttttcaaatt
gataggtctaccatggctctaagaaaccttcacaaagtgctggaaatgtcatttattttg
atctaggtgatggttgcacaggtgcctacttaagttattgatttagaatttgtgcccctt
EXON 5  283 bp
atgtcctctgtgggctggaaatgattgctttacaacaggaattctgtctcaatggaattg
ctttacttcagggaaaacagaaatgggcaaactgcagtggtctatgcaggtatggatgga
ccattctcacacctaaccaagcaatgtttgcttttcctcctcctttcttcccatcactag
TTGCCATGTACCGAGAACCATCTTTGCATGATGTTGGGGAAACGGTCCCGAAGCCTGGGG
TGACGCCAAGTAAAAGCACAAGTGCGTCTGCAATAATGAATGGAGGCAAACCAGTCAACA
AGAGTAAGACAACATAGCCAGATCCTCACAGGTGTTGTGACTTATTCGTCCTGAGCACAG
TTGAGTGATTTATCCTCACCAGACATTCCTGCTCCGTGGCTGAAGAGCAGCAGGAAGTAA
GCTAATGCTTATTCTTTGCTGTCTCCGAACTTCTCTGTTGCAA
gtggataaatctcaacctgttgcaccccccacaacaagaagacacctggataaccagcta
aactcagaccatggaatgccctaccagatatggaatgcctttttaatatcttttctgtga
ctgtgacacttcatgtgaatgacatacttcacaagtacactcgataccttgcctgctgac