--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (87637 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (12 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1309       1335   0    Initial     27    69    Marginal
tcttcgaaccagaacctcggcctgaccggcactttggctccaaaataactttatttttgg
gggagaaagcacatcacgaaccagtcaaaatcgtggtttatttctgtaacgtgaagactt
ctgctcttttttctttgtttgtttttttcgtaaacatctgggtgtatatcaaacggcaag
ATGTCCAGTAATGTCCCGGCGGATATG
gtaagtgacggataagttatgacactgatttaattgtggtttccaatcttatttaatcgg
aaagacggcaggcgtggggcgaagatttgctggggactgtcgaaaagccactgtgctgag
cgatttggagaagttggagcttctggtttcccccttttaggaagtactgcttttaatatg

Exon  2 +       9662       9711   1   Terminal     50    72        Good
atagattgacttgtaaaggatttagtgatttcggggcattttgtttttgtctccatactt
ttaactgcatatatatatgtagagagagagagagagagagagagattctctattggttgg
tcaaatctagtagcatttttggtcttaagtaaatatatatttgggtaattttctgactag
ATTTTGAGAAGAAAATGTTCTTTCTGCTGAAGAAAATTGTTGAAGTTTGA
cattaacatttttgtttatgtacttaagatggcaatttattgtgtctagacaaaatgttc
ttatgatatatgtttttctttactttcatataaaattagtgtttttctttgccttagaaa
tagtcttgcttttgtatcctgctattctcattgtcatgttaaatcaagtttagcctaaag

Exon  3 +      22950      23060   0     Single    111    44    Marginal
cacaaagggaagcccatcagactaacagctgatctcttggcagaaactctacaagccaga
agagagtgggggccaatattcaacattcttaaagaaaagaattttcaacccagaatttca
tatccagccaaactaagcttcgtaagtgaagaagaaataaaatcctttacaaacaagcaa
ATGCTGAGAGATTTTGTCACCACCAGGCCTGCCCTAAAAGAGCTCCTGAAGGAAGCACTA
AACATGGAAAGCAACAACAGGTACCAGCCACTGCAAAAACATGCCAAATAG
taaagaccatcaatgctaggaagaaactgcatcaactaatgagcaaactaaccagctaac
atcataatgacaggatcaaattcacacataacaatattaaccttaaatgtaaatggacta
aatgctccaattaaaagacacagactggcaaattggataaagagtcaagacccatcagtg

Exon  4 +      23916      24251   0     Single    336    41    Marginal
cacatagttggaagtaaagcactcctcagcaaatgtaaaagaacagaaattataacaaac
tgtctctcagaccacagtgcaatcaaactagaactcaggattaagaaactcactcaaaac
cacacaactgcatggaaactgaacagcaagctccggaatgactactgggtacataacgaa
ATGAAGGCAGAAATAAAGATGTTCTTTGAAACCCATGAGAACAAAGACACAACATACCAG
AATCTCAGGGACACATTTAAAGCAGTGTGTAGAGGGAAATATATAGCACTAAATGCCCAC
AAGAGAAAGCAGGAAAGATCTAAAATTGACACCCTAACATCACAATTAAAAGAACTAGAG
AAGCAAGAGCAAACACATTCAAAAGCTAGCAGAAGGCAAGAAATAACTAAGATCAGAGCA
GAACTGAAGGAGATAGAGACACAAAAAACCCTTCAAAAAATCAATAATCCAGGAGCTGGT
TTTTTGAAAGGATCAACAAAATTGAGAGATTGCTAG
caagactaataaagaagaatcaaatagaagcaataaaaaataataaaggggatatcacca
ctgatcccacagaaatacaaactaccatcagagaatactataaacacctctacgcaaata
aactagaaaatctagaagaaatggataaattcctggacacatacaccctcccgagactaa

Exon  5 +      24816      25175   0     Single    360    55    Marginal
atgaggccagcatcatcctgacaccaaagtccggcagagtacacaacaaaaaaggagaat
tttagaccaatatccctgatgaacatcgatgcaaaaatcctcaataaaatactggcaaac
tgaatccagcagcacatcaaagagcttatccaccatgatcaagtgggcttcatccctggg
ATGCAAGGCTGGTTCAGCATATGCAAATCAATAAACATAATCCAGCATATAAACAGAACC
AAAGACAAAAACCACATGATTATCTCAATAGATGCAGAAAAGGCCTTTGACAAAATTCAA
CAGCCCTTCATGCTAAACATTCTCAATAAATTAGATATTGATGGGACGTATCTCAAAATA
ATAAGAGCTATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAA
GCATTCCCTTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTTCTATTCAAC
ATAGTGTTGGAATTTCTGGCCAGAGCAATCGGGCAGGAGAAAGAAAGGGTATTCAATTAG

gaaaagaagttaaattgtccctgtttgcagatgacatgattgtatatttagaaaaccccg
tcgtctcagcccaaaatctccttaagctgataagcaacttcagcaaagtctcaggttaca
aaatcaatgtgcaaaaatcacaagcattcttatacaccaataacagacaaacagagagcc

Exon  6 +      26319      26479   0    Initial    161    53    Marginal
aaactaaagagcttctgcacagcaaaagaaactaccaccagagtgaacaggcaacctaca
gaatgggagaaaatttttgcaatctactcatctgataaaaggctaatatccagaatctac
aaagaactcaaacaaatttacaagaaaaaaaacaaccccagcaacaagtgggcgaaggat
ATGAACAGACACTTCTCAAAAGAAGACATTTATGCAGCCAATGGGCACGTGAAGAAATGC
TCATCATCACTGGCCATCAGAGAAATGCAAATCAAAACCACAATGAGATACCATCTCACA
CCAGTTAGAATGGTGATCATTAAAAAGCCAGGAAACAACAG
gtgctggagaggatgtggagaaataggaacacttttacagtgttggtgggactgtaaaac
tagttgaaccattgtggaagacagtgtggtgattcctcaaggatctagaactagaaatac
catttgacccagccatcccattactgggtatatacccaaaggattataaatcatgctgct

Exon  7 +      26779      26911   0    Initial    133    50    Marginal
ccatttgacccagccatcccattactgggtatatacccaaaggattataaatcatgctgc
tataaagacacatgcacatgtatgttcattgcagcactattcacaatagcaaagacttgg
aaccaacccatatgtccatcagtgatagtctggattaagaaagtgtggcacatatacacc
ATGGAATACTATGCAGCCATAAACAAGGATGAGTTCATGTCCTTTGTAGGGACATGGATG
AAGCTGGAAACCATCATTCTCAGCAAACTATCGCAAGGACAGAAAACCAAACACCGCATG
TTCTCACTCATAG
gtgggaattgaacaatgagaacacttgaacacaggaaggggaacatcacacactggggcc
tgtggttggatggggggaggggggagggatagcattaggagatacacctaatgtaaatga
cgagttaatgggtgcagcacaccaacatggcacatgtatacatgtgtaacctgcacattg

Exon  8 +      28792      28892   1   Internal    101    67    Marginal
cttactccccctttcaccagctaaaagtaaatgaagtaaaaacaaatctctaaatgtgtg
attacaaaatttacacatacatttatcttttcagaaatcacatttgcataaagttcattg
agttcaatgtctgctaatttataagatagtttccctaccatatatattcaaccaaggcag
CATATTCCAGTGGTGGTATTGTTAATTATATCAGAATTAAGAACATCAACACTTTCTCAA
AAGTACTGAATGAGAGCAAGTTTCTGGATCTTCTAATTCAG
gtaatttaatttaacaaagagctttaggactagttgtaatcacctagcaattactcataa
aattgtttttaatttcatctatgttccttgagagccactgtgttgatgattctgttttgg
ggatttatgtgcagtcagataattcatattttgtatttctgtacgaaatcaatggaacaa

Exon  9 +      34950      35043   0    Initial     94    83        Good
cctacaaagctaacagaattcgtagcatagcattctgaagtttagtggaaaatagccctg
agcacctacctaatatgtcctaaaagcatcattgtgtgataaatgatatttatgatgact
ccatgcagaaactggttatttgatagatattgaaaggtgttaaacttacctacatcagaa
ATGTATAGATTATTCAGCTGTTCTCAAGTTGAGGTAGCTCCCAAAGATAAAGCTAAGATA
GACCTGTATGAGTTCAGTTCCTTCATTGCAGTAG
gtaagttatccagacatctttcattgagtgcttttctatttgaattggcatcttgtttaa
tcactttgtgaatgacatggaaacccactcatctggtaacttttagatagatttttaggc
aattcagaaagcacactgagaatttccctaaaatgtcagtaacattgcctgaagttttat

Exon 10 +      41183      41329   0   Terminal    147    55    Marginal
tgctaggttatatggaaatactgtgttattttagatcaggaaccagagcgtccttggttt
ttgttatctgtgggcgggggtcagaaggcagggtcctgaaacatagaccccactaatgcc
tagagatgactctatatttagtggaaacatatcttcttcactgcctccatccctgtccag
GCTTTTGTCATCTCAACTAAACTCTTGCAAAGTCTTCTAAGGGGTCTGTCAGCTTCTGTT
CCTAAGGAAAGAATGCTCTATCCGTACAACAGCCATGATGACCTTCAGTGTAAATTGGAC
CATGCTCCACTGCTGAAAACTTTTTAA
tggtttcacagtccactttaatatttaaattccttcccaggctgtgtgagatctgactct
tgcttgctcttcagccttattggtggctgtcttcctcagttaccattctgtgctgattta
tttattttttcctcagatgtgccaaggctttttcttttctgctttggagtttttatgcat

Exon 11 +      73551      73700   0   Terminal    150    79        Good
tctgacacacacacacaccctttaaataataggaaataaaatcaaatatcaaattcccat
tctttttaaaaaagttttatagaatttaaataaaaaccacaatatggcattggtaataat
ttaggatgtgattgaaatgaaaagcctttgagtcttcttttttacttaaaaaatttttag
ATTTATGTTAAAAGAATCATTGTCTTCTTTCAGATAAATTTGCGCCTCATTTTGGTAAGC
GGAAAAACAAAAGAGTTCCTGTTTTCTCCTAACGATTCTGCTTCTGACATTGCAAAGCAT
GTATATGACAATTGGCCAATGGGTGAGTGA
tatttttctcttgagtatgaataatgttgattcttatgccctaccttgtctcacaaacat
tttgaaactgttatataacatttaaaagaacaaccgaaaattgagagtataaggctcaga
tttagaggatcattgtacccttccttatcttgctcttcagcagtctcattcccaaatggt

Exon 12 +      83152      83229   2   Internal     78    85        Good
taaattttaaatgttatttctgataatattaacctaattttgtgaaggtactctgagtta
agttgaatctgttaaagaagtcataaaaaagcaatcaatttttaaaatggttttaaatct
ggatagtgattttaataggtcgatatatgtgtaactaatcatcttttgcttttcacatag
CATTAAAACTTCCTTTTGGCAAAACAACAGTGATGCATTTGGTGGCCAGAGAGACATTAC
CAGAGCCAAACTCTCAAG
gtaagccatgcactggaaaagtatctcagttgaggcacaaagacaggcattcaaaaatgc
taggtttttcttggatatgctgagggaagggaagtttgcatagtttatgaatagagattg
tcaagcaaataaccagacatttttgaaacatgctaaaattaaaagaacatttattacagc

--------------------------------------------------------------------------------