--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (180511 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (40 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       4706       4832   2   Internal    127    87        Good
aagataatcatatgtttaaatttgaagtgtaatgtttttctaagataaaataagatctta
aagtatttaataatgttctttttcacagtagtgttatgtgcaaactattgaaacaagtat
gtactgaatcaatttgatttataagtatatgccaattatatgattattttcatttggtag
GCTTGAGTTTGAAGAAACAGAAGAACCTGATTTTACTGCATTATGTCAGAAATTAAAGAT
ACCAGATCATGTCAGAGAGAGAGCTTGGTTAACTTGGGAGAAAGTTTCATCTGTGGATGG
AGTATTG
gtaaggattttcttaaaacgttttgaaatttttttttctcattttaaaaacaacttcaaa
tcactatacaaaaattgaaagatagaaaaatataaagacaataaaagctaataataattc
cattacccagaggaaatttacctctgctaacattaaaaatgtttgaggccgggcacggtg

Exon  2 +      14433      14530   0    Initial     98    41    Marginal
accgggacgcaaacccacaactcgagggcttagaccttcactgctgagctgccgccactg
tcctccgtgcgcggagtgtcgctgaagtcactggcgtcactaaccaaggcgtgcccgccc
aaggtgccctggtcctggtcgtccctatcgatgacccttcgtcaatacctcaggtctaaa
ATGCTTTCCTCCGAGCCCGAGTTCCTCCTGTCGGGCAAACTCCGCCCTGTCTGTGCCTTG
CTGCTTGGCCAGGGCCCGCCGTCCTTCTTCGCCAGCAA
gtgtgggcttccaaagacagggctgggcccggcctgggcctccctgaaggcagagaagga
cgggccctgtggaggcagccccatgtcgggctgaagaggctggcctgcctgcccccctgg
gagacaccctttccaaaatggaagagctgggtggacagcgcggggagaagcccacaaggg

Exon  3 +      17497      17600   0   Internal    104    70        Good
ctgccagggccaccacctgagccaggtacaagttttggggggacacacggaagtcggggc
actgccgtgagatagttctggcttacatctactgccactgcctgcagccctggaaggctg
ggctgcgcctggctggcccctgccagccccgggctgtgcggctccactctttgcctttag
GTACTCCCGGATGGCTTCCGCAATGTCCCGGTCCACGGAATCATCATTGAATCTAGCACC
AACGGGCCAAAGTCTGCAGTTTCCTCCTCCCTCATGGGGTCAAA
gtcagcaacaagaccacaggcaggcaatgcgggctgctccttgtgcacggtgggcttggc
agctggcttggcgtctgccctgtggcccctctgtgcagcgcgctcatcggtggtgccccg
agcaaccccgctgcgctgcagcgtgctgatgagcatctgcacccgggcgctcaccgacac

Exon  4 +      17749      17836   0    Initial     88    80        Good
tctgcagtttcctcctccctcatggggtcaaagtcagcaacaagaccacaggcaggcaat
gcgggctgctccttgtgcacggtgggcttggcagctggcttggcgtctgccctgtggccc
ctctgtgcagcgcgctcatcggtggtgccccgagcaaccccgctgcgctgcagcgtgctg
ATGAGCATCTGCACCCGGGCGCTCACCGACACGCTCTCCACCCCCTCGTCAGCCTCCGAG
AAGCACCCGGGGAACCTAAAGCTCCCTG
gtgggccaaaggcctcccatttggactggggagcaacccctggagtagcgttcctgagaa
acattctagcagaaggggagggacgcgcagagggacgacgctttatttctctgccagctt
catatactcaaaaggttggcagcggggtgcagtggctcaagcccgtaatcacagcacttt

Exon  5 +      40025      40140   0   Internal    116    92   Excellent
agtgtgaaatgaaatcctttcaaatatatgccatcagaaggatgtgttacaaatatacag
tattacaaacatttattttgtatgctgaataagaaaaaatcagttataatacagttttaa
catagtatccagtgtgtgaattatttaatgaaatatttgatctttattttttgttcccag
GGAGGTTATATTCAAAAGAAAAAGGAACTGTGGGGAATCTGTATCTTTATTGCAGCAGTT
GACCTAGATGAGATGTCGTTCACTTTTACTGAGCTACAGAAAAACATAGAAATCAG
gtaaagtttcttgtataaatataagcctctgccataaaaggaaacgaattctggattttc
ctctcaatagacttttgtgaattagtgagaaatgctaaaataaagtaaaacaaaaagaac
ttggaccaaatagtgaactgccattctctcatggagccgttatgaaagtgtatttatgct

Exon  6 +      42506      42625   2   Internal    120   100   Excellent
taatagaggtgtaagttgaaggctaattatttttgcaaaaagtaattccttccaaaggat
atagtagtgatttgatgtagagctgataatcttttgaattgaaatatctatgatttgaaa
acgaaataacacaaatttttaaggttactgatttacttttttctattctttcctttgtag
TGTCCATAAATTCTTTAACTTACTAAAAGAAATTGATACCAGTACCAAAGTTGATAATGC
TATGTCAAGACTGTTGAAGAAGTATGATGTATTGTTTGCACTCTTCAGCAAATTGGAAAG

gtaaagtaaacattttattaggtttacactctgattttttatgtcattgttcacaattag
attctgggaattatttaacacatttagtaaagttagtaagtattaattcttagacttgtc
ccttttaatgttagctcattaattcttagctttcttatttatccagtaatatgcattctg

Exon  7 +      50776      50910   0     Single    135    40        Poor
taaaaagttaaacaaaattgacaagcctttagctagattaactaaggaaaaaagagagaa
gatacaaataagatcagaaatgaaaaaggagacattacagctgatactgcagaaactaaa
agtatcattagtggcttctataagcaactatatgccaataaactggaaaatatagaagaa
ATGGGCAAATTCCTAGACATGTACAACTTACCAAGATTGAACCAGGAAGAAATCCAAAAC
CTGAACAGACCAATAACAAGTAATGAGATTGAAGCCATAATAAAGTCTCCTAGTAAAGAA
AAGCCTGGGACCTGA
tggcttcactgctgaattgtaccaaacatttaaagaagaactaataccaatcctacttac
agtattctggaaaatagactaggaagaaatacttctaaactcattctacaaggcctgtat
taccctgataccaaaaccagataaagacccattaaaaaaagaaaactataggccagtatt

Exon  8 +      51789      51911   0   Terminal    123    58    Marginal
aacctaaagactccacaagaaaactattagaactaataaacatgttcagtaaagttgaag
gatagaaaatcaacatacaaaaatcagtaatgtttctgtatgccaacagtgaataatgtg
aaaaagaaatttaaaaagtagtcctgtttacaatagccacacataaaataaaatgcctag
GAATTAACCACAGAAGTGAAAGATCTCTATGATGAAAACCATAGAATACTGATGAAAGAA
ATTGAAGAGCACACCAAAAAAATGGAAAAAAATTTTATGTTGTTCATGGATTGGAAGAAT
TAA
tattgttaaaatgtccatactacccaaagcaatctatagattcaatgcaattcctatcaa
aataccaatgacattcttcacagaaatagaaaaaacagtcctcaaatttatatggaacta
caaaagacccagaatagcgaaaactatcctaagcagaaagacgacgttgcttgacttcaa

Exon  9 +      60241      60383   1   Internal    143    59    Marginal
aatattagtacataatttgtagtagatatggatgaaattgttatccttctaatgaaacct
aataagtaaaagtagtagaatgttaccaagattatttttgacctaagttatagttagaat
acttcattattttatatgatggatgtacaattgttcttatctaatttaccacttttacag
AAACAGCTGTTATACCCATTAATGGTTCACCTCGAACACCCAGGCGAGGTCAGAACAGGA
GTGCACGGATAGCAAAACAACTAGAAAATGATACAAGAATTATTGAAGTTCTCTGTAAAG
AACATGAATGTAATATAGATGAG
gtaatttaacttcatgatttctttaaaacagttaaagtagatttagatgtaagttctccc
taacaatatttacttcttttgttatgagcatgttttttttgtaattagtgctaactcttt
tgcagtagcaaaatatttagaaaaaattaattcgttatatttagttactttgattttaaa

Exon 10 +      62752      62822   1   Terminal     71    66    Marginal
tgagtatataatcaaatgtattagcatcattttgtgatttatactagaaatcaatcttta
ttgaattttttccaaaatcaaagtatagacttttaaacttctaaataccattaaatagct
aaattttaatagctaaatataaaccattaaatttgctttggtaagcctcattaagcgtag
GAACCATGATTAATGCCATCAACATTATTGGCATTACTACATTGTGGAACATCTCTTTTG
AGGATTTTTAA
gaactgcttaattgaaaatacaaatgtatttgttgaaatgactgtgactattgcagaagt
gttttaccttagtgatattccatccatctacctgttttgtttcgcattttgctacaaatg
tctttccaatgagaacagaataactgagagctttgcatggtaagacgaaatatgtggaga

Exon 11 +      70831      70880   0   Internal     50    53    Marginal
ttaaagatttaagtaaaatgtaatttcttataaaccacagtcttatttgagggaatgtag
agacaagtgggaggcagtgtatttgaagatacatttaacttgggagatggaaaacatttc
attttttctttttttctcccttcattgcttaacacattttcctatttttatcccctctag
GACTGTTATGAACACTATCCAACAATTAATGATGATTTTAAATTCAGCAA
gtgatcaaccttcagaaaatctgatttcctattttaacgtaagccatatatgaaacatta
tttattgtaatatcttggcaaagaaacttgaaattaaaagttaaagtactgagttctttt
taaaatactaatctcctatctaacatgtagttatccataatcttttcttgcttttttaat

Exon 12 +      75909      75975   2   Terminal     67    57    Marginal
aatattttctttctttataatccttattctgtacacttttttctatttaaaaattttttc
aatttcataaagatttttgccaaaaacaaaggcaaacacacacattagcctaggcctaca
caggatcaggattaacaataccactgtcttctgcctccaaattctgtcccaagtcttcag
GGACAATAAAATGCATAGAGCTGTCAACTCCTATGATGATGATGCTATCTTCTGGAATAT
CTCCTGA
aggagctgcctgagggtgttttacatttaacttttttttttttttacaagtagaaggagg
atgctctaaactaataaaaagtatagtataataaatacataaaccagtaacatgttcatt
attaagtattatgtactgtacataattgtatgtactatacttttatatgactggcagtgc

Exon 13 +      77020      77076   0   Internal     57    64    Marginal
gtggtacatgcctataatcccagcctcttgggaggccaaagcaggaggatctcttgagcc
caggagtgtgaaggccagcctgggcaaaacagtgagactccatctcaaaaaaaaaaaaaa
tttcataattgtgattttctaaaatagcaggctcttatttttctttttgtttgtttgtag
CGATACAAACTTGGAGTTCGCTTGTATTACCGAGTAATGGAATCCATGCTTAAATCA
gtaagttaaaaacaatataaaaaaatttcagccgggcgcggtggctcacgcctgcaatcc
cagcactttgggaggccgaggtgggcagatcaggaggtcaaggcatcaagatcatcctgg
ccaaaatggtgaaaccctgtctctactaaaagtacaaaaattagctgggcgtggtggtgt

Exon 14 +      77479      77510   0   Internal     32    59    Marginal
tcccttgaaccagggaggtggaggttgcagtgagccaagattgtgccatttcaccccagc
ctggcaacagagcaagacaccatctaaaaaaaaaaaaaaaaaaaaaaaaaattcaatgct
gacacaaataaggtttcaattaaacaacttctttttttttttttaaattatctgtttcag
GAAGAAGAACGATTATCCATTCAAAATTTTAG
gtaaattttttacttttagtaaaaaatttttttctttttatagaagtaagtattttataa
tctttttttttttcctttagcaaacttctgaatgacaacatttttcatatgtctttattg
gcgtgcgctcttgaggttgtaatggccacatatagcagtaagttaaattttcataaataa

Exon 15 +      78673      78831   1   Internal    159    86        Good
acactcaaaattggaaggctatttcctatgagtccgtagactccaaaataaaaaattctg
ctctaaataaaaatggtttaacctttctactgttttctttgtctgataataacttccaaa
aaaatacctagctcaagggttaatatttcataaatagttacttttttttttcatttttag
GAAGTACATCTCAGAATCTTGATTCTGGAACAGATTTGTCTTTCCCATGGATTCTGAATG
TGCTTAATTTAAAAGCCTTTGATTTTTACAAAGTGATCGAAAGTTTTATCAAAGCAGAAG
GCAACTTGACAAGAGAAATGATAAAACATTTAGAACGAT
gtgaacatcgaatcatggaatcccttgcatggctctcagtaagtagctaaataattgaag
aaattcattcatgtgcatatggctaacaaattattgttagtgagaggtgtttcttaacat
ctacctcaagaacatatagggaatttaatgaataatgttatttcagtctatagcccaagg

Exon 16 +      80179      80224   2   Terminal     46    48    Marginal
ctttgtagattctggatattagccctttgtcagatgggtagattgtaaaagttttctccc
attctgtaggttgcctgttcactctgatcgtagtttcttttgctgtgcagaagctcttta
gtttaattagatcccatttgtcaattttggcttttgttgctattgcttttggtgttttag
TCATGAAGTCCTTGCCCATGCCGATGTCCTGAATGGTATTGCCTAG
gttttcttctagggtttttatggttttaggtctaacatttaagtctttaatccatcttga
attaatttttgtacaaggtgtaaggaagggatccagtttcagctttctacatatggctgg
ccagttttcccagcaccatttattaaatagggaatcctttctccatttcttgtttttgtc

Exon 17 +      81048      81190   1   Terminal    143   100   Excellent
ctaagtatatatcttttaatttgtatcagtatatagaagtggtaattaaaaaattaagac
tttaggtatgccataatcctaatttgcacatgtaaccttagttttaatttccttacgttt
tgaatttttaatgactaagcgataatttatttcttagtgttttcttgtattgccatatag
ACAGAGTGAATAGAGGAGAGAAACATGGGAAATTGATAGAAGAATGTTACACTCCTATTA
TTGAATTTCATAACTACTTATGGAATGAATTTACACTTGATAAGGAGTACTTAGAAGAAA
ACTTTCTGAATCTGGGTAATTAA
gtgaaagtaaaaataaatagataagtaaataaaataagcacatagagtactttttaaagg
cttatgtgtcctctcctcccagaaattgatattgagatattcctgtatcatctgaaagtg
actattgttatttcttttagagaattaattttatttctatcaacacatatttattgaaca

Exon 18 +      87812      87896   0    Initial     85    52    Marginal
ttcattaaataattcattcattaaataatgaagttgaacgtaatgaatttaatgaagttt
aataggtgtagtgggagtaacaatgagaatgaaagtgtaggaggttgtagtcaaagagtt
gtttcaccttagaatttctggagacagaacatttctgggtagtttactgtattttaagaa
ATGATCTTGGGAGTGCATGAGGATCCTGGCCAAGGAGCCAGAAAGTACAGTGAGCAAGAG
TCCAGGACATGTAGCAAGGAGGAAT
gtgactgaaataaagactaatgtcttcagtgcttgaggggagtaaccaggagacaagtgg
gactaaatggggcagagggctagagaggtcctgaaagcaaaactcctggctcacttaaaa
aaaaactaatctctctctcaatacctaatctaatgtctaacatatagaatttaggtgcat

Exon 19 +      92614      92808   0     Single    195    46    Marginal
atctggtgggtacccctctgggacgaagcttccagaggaaggaacaggcagcaatctttg
ctcttctgcaacctccactggtgataccaggcaaacagggtctggagtggacctccagca
aactccagcacacctgcagcagaggggcctgactgttagaaggagaactaacaaacagaa
ATGAATAGCATCAACATCAACAAAAAGGACGTCCACACAGAAACCCCATTTGAAGGTCAT
CAACATCAAAGACCAAAGGTAGATAAATCCATGAAGATGAGGAAAAACCAGCACAAAAAG
GCTGAAAATTCCAAAAACCAGAGCGCCTTTTCTCTTCCAAAGAATGACAACTCCTCCCCA
GCAAGGGGAGTTTGA
cgaattgacagaagtaggcttcagaaggtgggtaataacaaactcctccgagctaaagga
ccatgttctaacccaatgcaaggaagctaagaactttgaaaaaaggttagaggaattgct
aactagaataaccagtttagagaagaacataaatgacctgacggaactgaaaaaacacaa

Exon 20 +      94009      94605   0     Single    597    49    Marginal
tccctatttaataaatgatattgggaaaactgactagccatatgcagaaaactgaaactg
gaccccttccttacaccttatacaaaaattaactcaaaatggattaaagacttaaacata
acacctaaaaccataaaaaccctagaagaaaacctaggcaataccattcaggacataggc
ATGGGCAAAGACTTCATGACCAAAACACCAAAAGCAATGGCAACAAAAGCCAAAATTGAC
GAATGGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACTATCTTCAGAGTG
AACAGGCAACCTACAGAATGGGAGAAAATTTTTGCAATGTATCCATCTGACAAAGGGCTA
AAGTCCAGAATCTACAAGGAACTTAAACAAATTTACAGGAAAACAAACAACCCTATCAAA
AAGTGGGTGAAGGATATGAACAGACACTTCTCAAAAGAAGATATTTATGTGGCCAACAAA
CATATGAAAAAAAGCTCATCACCACTGGTCATTAGAGAAATGCAAATCAAAACCACAGTG
AGATACCATCTCATGCCAGTTAGAATGGTGATCATTAAAAAGTCAGGAAACAACAGATGC
TGGAGAGGCTGTGGAGTAATAGGAATGGTTTTATACTGTTGGTGGCAGTGTAAATTAGTT
CAACCATTGTGGAAGACAGTGTGGCGATTCCTCAAGGATCTAGAGCCAGAAATAATATTT
GACCCAGTAATCCCATTACTGAGCATATACCCAAAGGATTATAAATCATTCTACTAA
aaagaacatgcacacatatgtttattgcagcactattcacaatagcaaagacttgaaacc
aacccaaatgcccatcagtggtagactggataaagaaaatgtggcacatatacaccatgg
aacactatgcagccataaaaaaggatgagttcgtgtcctttgcagggacatggatgaagc

Exon 21 +      94722      94853   0     Single    132    49    Marginal
aatatttgacccagtaatcccattactgagcatatacccaaaggattataaatcattcta
ctaaaaagaacatgcacacatatgtttattgcagcactattcacaatagcaaagacttga
aaccaacccaaatgcccatcagtggtagactggataaagaaaatgtggcacatatacacc
ATGGAACACTATGCAGCCATAAAAAAGGATGAGTTCGTGTCCTTTGCAGGGACATGGATG
AAGCTGGAAACCATCATTCTCAGCAAACTAACCAGGAAGAGAAAACCAAACAACACATGT
TTTCACTTATAA
gttaaaactgaacagtgagaacacatggacacatggaggggaacatcacacaccggggcc
tgtcagggggtgcgggtctaagggagggatagcattaggaaaaatacctaatgtagatga
tgggttgataggtgcagcaaaccaccatggcacgcgtatacctatgtaacaaacctgcac

Exon 22 +     101179     101264   1   Terminal     86    61    Marginal
agagagtggggcaataatcaggaaggttttctaaagtgctgtttggcaatggtcctcaaa
cttgagcatgcatcaaaattaccaggagggcttgttaaaacacatattacagattgctgg
gcccagtcacaaagtttccagtgtagggtccaagaatttgtatttctgatatgtttccag
GTGATACTGATGCTGCTGGTCTGGGTACTACACTTTGTGAGCAACATTTTAAGAACATGA
AACACCTGGACCAGTCCCCCATCTAA
ggccatgccagcctatgagaataaaaaaaatgcacctctgtagtcccagctacttgggag
gctgaggagggaggattgcttgagcctgggaagttgaggctgcagggagccgtgactgca
ctactgcattccagtctgggtgacagaatgagacactgtctcaaagaaaaacgaaaaaaa

Exon 23 +     103703     103803   1   Terminal    101    82        Good
tctgtgtgtgtgtgtgtatgtatgtatgtatgtgtgtgttatgtaattgaaattgtgtct
tgaggatcaatacctagaagtaagaatgctgggtcaaagggttaatgtgtgtgtgtatgt
gtgtgttagatattgccaaatcccatccataaggtttgtactatttttcattcccaccag
AAATGTATGAAGGTAGCAATTTCTCCATGACGGCCACTGTCCAAATTTTGCCAAGTAATG
ACATTAAAATATTCTTCTCATCTATTATCACCATCATTTAA
aaaagaatttctcccattttaataaaggaaaaaggacaaatcagaaaaaaaggataagaa
gagccctttaaattgtataaatatagttcttgttgtgattatttttcttttcttgctgaa
gacaaatgcatctctaccctgtatcagacgaatctttatttgatcatgtctcccctacct

Exon 24 +     106111     106233   1   Internal    123    67    Marginal
ggcttagtgctatcattttcaggtaatcaaaagtaaaatcatcagagttctaatattaat
ataggtttttctgaataaagggggaagggaagagaaaaccctcagaatatatgacttacc
acaaagtacaacactagcaaaggaaaataaattttgttctggtacactttttttccatag
TTCTAGATGAGAAAACCATGTTTGTTATCTGTTATGTATTGCTTTATGAAGAATCTTACA
AAACTTTTGATTCATTTATCTTCCTGTTGACAAGAGACACCAAAAAGTTTCTTTATGAAC
ATA
gtaataacaactatttaatgactgttttatttgcattttaaagttatattcatgttttat
gatcttgccttaagttgagatctttaagctgaggagagttctgagaaatctcaaagttat
acaattctccacccctttcccccagatcagtagattggtagttgcttctcaactcagtat

Exon 25 +     109998     110161   1   Terminal    164    56    Marginal
tagaagcagtgggagctgttaacgcttaccatcgtaaaggcacgtccaattttcagtttg
gaagcactttcatcagctgcagtctcctttgggattcagattataacctctataacctcc
aatttatttgcaaattatctggatctttggatggttttataaatatttcctttttctcag
AAATACCCAAAAGAAACATGAAATTTGTTGCTGTAAAATTTCCGCTGGGTTCTTCAACAG
GAAAATATTTTCATTTGTTAGTCTTTAGAAAATCCATGAATTCCAAGGCTCAGTTAACTG
ACGAGCAACCTTTAAAAAATACAGTCAACGAGTCCAACCCATAG
gattataaatttaaagaaaagctgtgatctgtgaccagaatgaaaccacttgtcttctaa
acttgtatttcagtagtcaagatgaatactccaaagttaatgtttctttatgcctcagaa
tgttaagcttaagttatcaatcttattttcttttcagtgcagagtttcagagacttaaac

Exon 26 +     114794     115054   0     Single    261    48    Marginal
tctggtgggtgcccctctgggacaaagcttccagaggaaggaacaggcagcaatctttgt
tgttctgcaacctctgctggtgatatccagacaaacagggtctggagtggacctccagca
aattccagcagacctgcagcagaggggcctgactgttagaaggagaactaacaaacagaa
ATGAATAGCATCAATATCAACAAAAAGGACTTCCACACAGAAACCCCATTTGAAGGTCAC
CAACATCGAAGACCAAAGGTAGATAAATCCATGAAGATGAGGAAAAACCAGCGCAAAAAG
GCTGACAATTCCAAAAACCAGAATGCCTTTTCTCTTCCAAAGAATCACAACTCCTCGCCA
GCAAGGGAACAAAACTGGACAGAGAATAATAAACTCCTCCAAGCCAAAGGACCATGTTCT
AACCCAATGCAAGGAAGCTAA
aaaccttgaaaaaaggttagaggaattgctacctaaaataagcagtttagagaagaacat
aaatgacctgatggagctgaaaaacacagcacaagaacttcgtgaagcatacacaagtat
caacagccaaagcagaagaaaggatatcagagattgaagatcacctttatgaaataaagt

Exon 27 +     117640     118308   0     Single    669    67    Marginal
tttataagccaagaatcatcctgataccataacctgccagagacacaacaaaaaaagaaa
atttcggccaatatccttgatgaatatcgacgtgaaaaccctcaataaaatactggcaaa
ctgaatccatagcacatcaaaaagcttatccaccacaaacaagtcggcttcatccctggg
ATGCAAGGCTGGTTCAACATATGCAAATCAATAAACGTAATCCATCACATAAACAGAACC
AAAGATAAAAACCACATGATTATGTCAATAGATGCAGAAAAGGCCATTGATGAAATTCAA
CACTGCTTCATGCTAAAAACTCTCAATAAACTTCATATTGATGGAATGTATCTCAAAATA
ATAAGAGCTATTTATGGCAGACCCACAGCCAATATCATACTGAATCAGCAAAAGCTGGAA
GCATTCCCTTTGAAAACTGGCACAAGACAAGGATGCCCTCTCTCACCACTCCTATTCAAC
ATAGTATTGGAAGTTCTGTTCAGGGCAGTTAGAAAAGAGGAAGAAATAAAGCGTATTCAA
GTAGGAAGAGAGGAAATTAAATTGTCTCTGTTTGCAGAGACAATGATTGTCTATTTAGAA
AACCCCATTATCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCA
GGATACAAAATTAATGTGCAGAAATCACAAGTATTCCTATACAACAATAATAGACAAACA
GAGAGCCAAATCATGAGTGAACTCCCATTCACAAATGCTACAAAGAGAATAAAATACCTA
GGCATACAACACACAAGGGATGTGAAGGACATCTTCAAGAACTACAAACTTCACTGCTCA
AGGAAATAA
agaggacacaaacaaatggaagaacattccatgttcatggataggaagaatcaatcttgt
gaaaatggccataccactcaaagtaatttatagattcaatgctatccctatcgagctacc
attgacttcctttataaaattagaaaaaactactttaaatttcatatggaaccaaaaaag

Exon 28 +     118831     119123   0    Initial    293    47    Marginal
tgccacacatctacaaccatctcatctttgacaaagatgagacaaaggattccgtttaat
aaatggtgttgggaaaactggctagccatgtgcagaaaactgaaactggacccctttctt
acaccttatacaaaaattaactcaagatggattaaagagttaaatgtaagacctaaagcc
ATGAAAACCCTAGAAGAAAACCTAGGCAATACCATTCAGGACATAGGCATGGGCAAAGAC
TTCCTGACCAAAACACCAAAAGCAATGGTAACAAAAGCCAAAATTGACAAATGGGATCTA
ATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACTATCATCAGAGTGAACAGGCAACCT
ACAGAATGGGAGAAAATTTTTGCGATCTATCCATCTGACAAAGGGCTAAAGTCCAGAATC
TACAAGGAACTTAAACAAATTTACAGGAAAAAAGCAAACAACTCCATCAAAAA
gtgggtgaaggatatgaactgacacttctcaaaagaagacatttatgtggccaacaagca
tatgaacaaaagctcatcatcagcggtcattaatgaaatgcaaatcaaaaccacaatgag
ataccatctcatggccgttagaatggcgattattaaaacgtcaggaaacaacagatgctg

Exon 29 +     119648     119801   0    Initial    154    63    Marginal
attctaatataaagacacatgcacacatatgcttattgcagcagtatttacaatagcaaa
gacttggaacccacccaaatgcgcatcaatgatagacaggataaagaaaatgtggcacat
atataccatcgaatactatgcagccatgaacaaggatgagttcatgtcctttgcagggac
ATGGATGAAGCTGGAAACCATCACTTTCAGCAAACTAACACAGGAACAGAAAACCAAACA
CCGCATGTTCTCACTCATAAGTGGGAACTGAACAATGAGAACACATGGACACAGGGAGGG
GAACATCACACATCGGGGCCTGTCGGGGTTGGGG
gttagaggagggatagcattaagagaaatacttaacatagatgatgggttgatgggtgca
gcaaaccaccatggcacgtgtatacctatgtaacaaacctgcacgttctgcacatgtatc
ccaatacttaaagtataatacttttaaaaaatggtgaagacaagcctttttttaggactg

Exon 30 +     124295     124335   2   Internal     41    61    Marginal
ggaactcgaatcctagtttcttgacttctagtcaaatgttctcgtagtaacaggtagctt
tcaccctttttttcttactgatgttgtgctagttcgttcttgcattgctgtaaagaaata
cctgagactgggtaatttgtaaagaaaagagtagggtttagttggctcacggttcttcag
GCTGTACAGGAAGCATGGCATCAGCTTCTCCTCAGCTTCTG
gtgagtcctgaggaagtttatattaatggcagaagtcggaggggaaacaggcatgtcacg
tggtgacaataggagcaagaggaaggaggaggtcccatgccctttttaaacaagcagatc
tcttgtgaactaactgagcgagagctcggttatcaccaagggggtggtgctaaaccattc

Exon 31 +     153630     153761   0   Internal    132    73        Good
gatatgatgatgacaagcagttttcctattaatatatctttcccagcttgcatttaaata
gtctgctataataccaattaaatagacaagatgtatctgggtgtacaaccttgaagtgta
tgtataatctgtgattcttagccaacttgaaatgaagacttttcctttaaatatatctag
GTATCTTTCTCCTGTAAGATCTCCAAAGAAAAAAGGTTCAACTACGCGTGTAAATTCTAC
TGCAAATGCAGAGACACAAGCAACCTCAGCCTTCCAGACCCAGAAGCCATTGAAATCTAC
CTCTCTTTCACT
gttttataaaaaaggttagtagatgattattttcaagagcatggactctgaaactaggct
gactgggttcaaatcatgtttcttctactttctaggtacattactgggcaagtcacttaa
tatctctgtgtctcagtttcctcatctataaaatggaaatgataatgttgcgagatcttt

Exon 32 +     157114     157259   1   Internal    146   100   Excellent
tgcctcataataaaccagtaaacatgtttctctgggggaaagaaaagagtggtagaaaag
aggtttctgttaaaatgctacttaacagcattataattagagcgatttcatgatttgaaa
aaaatctacttgtaattcaaaatgaacagtaaaaatgactaatttttcttattcccacag
TGTATCGGCTAGCCTATCTCCGGCTAAATACACTTTGTGAACGCCTTCTGTCTGAGCACC
CAGAATTAGAACATATCATCTGGACCCTTTTCCAGCACACCCTGCAGAATGAGTATGAAC
TCATGAGAGACAGGCATTTGGACCAA
gtaagaaaatcaagcacttcaccttctctcctccctacttacttgttaactgattctttc
tttctttctttctttctttctttctttctttctttctttctttctttctttctttctttt
tctttctttctttctctctttctttcttttttttgagatagagtctcactctgttaccca

Exon 33 +     161157     161261   0   Internal    105    98   Excellent
tttaaacacactttgggttaaacacttcatgtagactttcaaactgagctcagtatggaa
agaaataactctgtagattaaacctttcttttttgaggctaaaagaaagaaaatggtatt
ttttaagaacaaaaccatgtaataaaattctgactacttttacatcaatttatttactag
ATTATGATGTGTTCCATGTATGGCATATGCAAAGTGAAGAATATAGACCTTAAATTCAAA
ATCATTGTAACAGCATACAAGGATCTTCCTCATGCTGTTCAGGAG
gtaggtaattttccatagtaagtttttttgataaatccatatccataacataacataggt
aattcatttgatctcatttattcattaatgagatcatatattctgtctgaccttattatg
taaattcacaaataaaaacttttatattatttatttgtaacttaaatagaattggaaaga

Exon 34 +     162424     162573   0   Terminal    150    98   Excellent
aagcctaagaagtaattttatttatttattattttttcctttataatatgtgcttcttac
cagtcaaaaagtattataaactattagaaaagaaaatctaaaggtagaaattttaaaatt
catttaacaagtaaattttacttttttttttttttttttttttttactgttcttcctcag
ACATTCAAACGTGTTTTGATCAAAGAAGAGGAGTATGATTCTATTATAGTATTCTATAAC
TCGGTCTTCATGCAGAGACTGAAAACAAATATTTTGCAGTATGCTTCCACCAGGGTAGGT
CAAAAGTATCCTTTGATTGGAAAAATCTAA
tgtaatgggtccaccaaaacattaaataaataatctacttttttgtttttgctctagccc
cctaccttgtcaccaatacctcacattcctcgaagcccttacaagtttcctagttcaccc
ttacggattcctggagggaacatctatatttcacccctgaagagtccatataaaatttca

Exon 35 +     162755     162794   2   Internal     40    67    Marginal
gtaatgggtccaccaaaacattaaataaataatctacttttttgtttttgctctagcccc
ctaccttgtcaccaatacctcacattcctcgaagcccttacaagtttcctagttcaccct
tacggattcctggagggaacatctatatttcacccctgaagagtccatataaaatttcag
AAGGTCTGCCAACACCAACAAAAATGACTCCAAGATCAAG
gtgtgtgttttctctttagggaagtagtaaagaatgagagggggattattttgatccaag
aataaaaaatataaagcattcttcatttcaaataagctagactcttgaaactctatttgc
ttatttaagtaacataataagaatatgggggcggggtgaagaaaatctatttacgactta

Exon 36 +     164806     164893   2   Terminal     88    49    Marginal
agcggatctctcggcagaaaccttacaagccagaagagagtgggggccaatattcaacat
tcttaaagaaaagaattttcaacccagaatttcatatccagccaaactaagcttcataag
tgaaggagaaataaaatcctttacagacaagcaaatgctgagagattttgtcaccaccag
GCCTGCCCTAAAAGAGCTCCTGAAGGAAGCGCTAAACATGGAAAGGAACAACCGGTACCA
GCCGCTGCAAAATCATGCCAAAATGTAA
agaccatcgagactaggaagaaactgcatcaactaatgagcaaaatcaccagctaacatc
ataatgacaggatcaaattcacacataacaatattaactttaaatataaatggactaaat
tctgcaattaaaagacacagactggcaagttggataaagagtcaagacccatcagtgtgc

Exon 37 +     164957     166039   0     Single   1083    83        Good
caaatgctgagagattttgtcaccaccaggcctgccctaaaagagctcctgaaggaagcg
ctaaacatggaaaggaacaaccggtaccagccgctgcaaaatcatgccaaaatgtaaaga
ccatcgagactaggaagaaactgcatcaactaatgagcaaaatcaccagctaacatcata
ATGACAGGATCAAATTCACACATAACAATATTAACTTTAAATATAAATGGACTAAATTCT
GCAATTAAAAGACACAGACTGGCAAGTTGGATAAAGAGTCAAGACCCATCAGTGTGCTGT
ATTCAGGAAACCCATCTCACGTGCAGAGACACACATAGGCTCAAAATAAAAGGATGGAGG
AAGATCTACCAAGCCAATGGAAAACAAAAAAAGGCAGGGGTTGCAATCCTAGTCTCGGAT
AAAACAGACTTTAAACCAACAAAGATCAAAAGAGACAAAGAAGGCCATTACATAATGGTA
AAGGGATCAATTCAACAAGAGGAGCTAACTATCCTAAATGTTTATGCACCCAATACAGGA
GCACCCAGATTCATAAAGCAAGTCCTGAGTGACCTACAAAGAGACTTAGACTCCCACACA
TTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGACAGATCAACGAGACAGAAA
GTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCACCAAGCAGACCTAATAGACATC
TACAGAACTCTCCACCCCAAATCAACAGAATATACCTTTTTTTCAGCACCACACCACACC
TATTCCAAAATTGACCACATAGTTGGAAGTAAAGCTCTCCTCAGCAAATGTAAAAGAACA
GAAATTATAACAAACTATCTCTCAGACCACAGTGCAATCAAACTAGAACTCAGGATTAAG
AATCTCACTCAAAGCCGCTCAACTACATGGAAACTGAACAACCTGCTCCTGAATGACTAC
TGGGTACATAACGAAATGAAGGCAGAAATAAAGATGTTCTTTGAAACCAACGAGAACAAA
GACACCACATACCAGAATCTCTGGGACACATTCAAAGCAGTGTGTAGAGGGAAATTTATA
GCACTAAATGCCTACAAGAGAAAGCAGGAAAGATCCAAAATTGACACCCTAACATCACAA
TTAAAAGAACTAGAAAAGCAAGAGCAAACACATTCAAAAGCTAGCAGAAGGCAAGAAATA
ACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACACAAAAAACCCTTCAAAAAAATCAA
TGA
atccaggagctggttttttgaaaggatcaacaaaattgatagaccgctagcaagactaat
aaagaaaaaaagagagaagaatcaaatagacacaataaaaaatgataaaggggatatcac
caccgatcccacagaaatacaaactaccatcagagaatactacaaacacctctacgcaaa

Exon 38 +     166563     166646   0    Initial     84    48    Marginal
ttcacagccgaattctaccagaggtacaaggaggaactggtaccattccttctgaaacta
ttccaatcaatagaaaaagagggaatcctccctaactcattttatgaggccagcatcatt
ctgataccaaagccgggcagagacacagccaaaaaagagaattttagaccaatatccttg
ATGAACATTGATGCAAAAATCCTCAATAAAATACTGGCAAACCGAATCCAGCAGCACATC
AAAAAGCTTATCCACCATGATCAA
gtgggcttcatccctgggatgcaaggctggttcaatatacgcaaatcaataaatgtaatc
cagcatataaacagagccaaagacaaaaaccacatgattatctcaatagatgcagaaaaa
gcctttgacaaaattcaacaacccttcatgctaaaaactctcaataaattaggtattgat

Exon 39 +     173837     173920   0    Initial     84    57    Marginal
cccataaagtgaatcaaaaattattattcattgaacacatcatctcttatcaaattcttg
tgaccttccttctggttgtataatagcctaaaaaacaaaaaaaggacaaaagcaagtttc
cagaaagctgttctgacttgcctacttctgaaaagtagtcctgtatggtgggttctgaaa
ATGAGGAACCAGGACTTGCAGAGTAGGCAGTTGCTGGAGGAAGAATGTGAGCTGCATGGG
AAAAGACAGGAGGATTTACAAAGA
gtgggtgtttaattggggatggaattaggtagttattctgatttttagatttttcatatc
ttttatttggtccaatgaagcagaaaatttaaatgaagttattacctttgcctgattttt
gacacacctcaaactataacttgaggttgctaactatgaaacactggcatttaatgattt

Exon 40 +     174127     174273   0   Terminal    147   100   Excellent
aggtagttattctgatttttagatttttcatatcttttatttggtccaatgaagcagaaa
atttaaatgaagttattacctttgcctgatttttgacacacctcaaactataacttgagg
ttgctaactatgaaacactggcatttaatgatttaaagtaaagaattctgtaatttgtag
ACTTCTGAGAAGTTCCAGAAAATAAATCAGATGGTATGTAACAGCGACCGTGTGCTCAAA
AGAAGTGCTGAAGGAAGCAACCCTCCTAAACCACTGAAAAAACTACGCTTTGATATTGAA
GGATCAGATGAAGCAGATGGAAGGTAG
gaaccagttttgaatgttttccagtagccgagatggtcatctggggaatccagagtctca
gcactgctcctggcttataccaatttctttcatgccaagtttatttggaagttgtgagaa
tggctcaaaataatagatatgagtgtagtgcaaagttaaaaacatcttacaaattgcata

--------------------------------------------------------------------------------