--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (151670 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (50 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1130       1579   0   Internal    450    81        Good
gcgggggccgaggcctcgggggaagccgatccctgcgccccccgggtctccgccacccgc
cagcgccgtccctgccaaccccgcccctgcagggcccgggccagttgggagcaggggccg
ggccgcgggcggagcctcccggtccccgccctcgccctcggccaactggcggtcttgcag
GCGGGCGGACCCTCGGCCGCGCTCGGGGCTCCGGCGCCGCCGCTCCTCCTGCTCGGCCTG
AGCTGCCCGGGCTCGGCGCGCGCTTGGGGCGAGGCTCGGCGGGCGCGGACGCGCAGCATG
GCGGTGGAGGACGAGGGGCTCCGGGTCTTCCAGAGCGTGAAGATCAAGATCGGTGAGTGT
CCGCCGGCAGCCACGCGTCCGACCCCCCGGCCCGACCCTGTCCTCTCCCGCGCCCGCCTC
CCCTCCGCAGATCCTTGCTGGGGACCCCGGCGGAGACGCCCTCCAGGCGCGGCGCGCTCC
CCGGAGAACGGCTGGTCCGGCTCCGCGGCCCCTCCCCACCTCCCCGCCTCCCCGGGCCTC
GGGCTGGGTCGAGTCGGCTCCGGGGTAACGCGGCTCCCTGCGCCTCCTCTGCGCCCGGAG
CGGCCCCGGTCCCTGGTAGCGGCGGAGGAG
gtggggtccctgcgccgagggacgtctgtccgcgtgtgcgcccgagcgtgtgccccgcgt
gtttgcaggagtgcgcgcgcctgaggctgtctgggcgcctgcacttcaggtgtcaaatcc
actgacgtcggggtctcggcatctccctttctccgctgcgcccagaaacttcctttccgg

Exon  2 +       8898       9032   0   Internal    135    58    Marginal
acagcctgctaattggattacctgtgggatggcaggagtgctgtggtaggaagagagaca
ggaatacaaggccttccgtagcagcaagtatatgtctattatgcatcaatgtgcaactat
gtatacggtgggtgagtgagtgaagaacaaaggcggagcttagaaatcatcccttcacag
ATTGCAAGAACAGTGTCGGCTGTGGAGGACGCCAAGGCCGAGAAAGAAAATAACTTGCCT
TCATTCAAGACAATGTGCTGTGTGGGAAATGCATGTGGACAGGTGAAGGAGCGGCTCCGT
CAGGCCGCAGCGGGC
gtccagcagtgacaggcggagtgagttgtggctggcccctgagaggcccctgacaggttt
tggggctccagcctttgtgtctgggaggctctggcacaggtgaaggggaactgagggtta
cgtcacctgtgacagatggttcagggtctctctgggtgtgacgcagagtccaaagtgaac

Exon  3 +      19556      19661   0   Internal    106    82        Good
gaggagttctggactcaagtctaataaaggaaaccccaggaaatccagaacagaaagtta
gcgtgtgacaggaggaaattcgttttgcactccgcagctgaatttgcggttgcctttcta
acgtcacatgggctgtgctgaggataggccaggtctctctcccctgcacggacatcgcag
ACGCTCACCGTGGTGGGGTGGATTGATGGACATGGTGAGAGCTGCATGGACATTGCAGAT
ACTACAGACATCGCAGACACTACAGACATCGCAGACACTTGCTGTG
gtgggtggattgatggatgcggtgtgagctatacggacatcactcgccatggtgggtgga
ctgatggacgcggtgtgagctgtacggacatcactcgccatggtgggtggactgatggac
gcggtgtgagctgtacggacatcactcgccatggtgggtggactgatggacgcggtgtga

Exon  4 +      21307      21434   1   Terminal    128    76        Good
cctagcggggtccccatacctgcagcaccagcatccccgggcacgcgtgtgaagtgctcg
aggcaggccgcacccctacagagctggggctggcgatctctttccaccggccctgcagag
agttcccgtccggctgaaatctgagaccccggtctaaagagtgtgattctcttcctgcag
AGTATCAGGAGCAGACCAGCTTCCCAAACAGTCACCCGCAGAGCTTCTGCTCCTTCGGGG
AGGGCCCTGACTTTCTCGTGGTAGAAATCCTCCACCCGGCCAGGTTCCGGCTGCCCCAGG
CCCCCTAG
aagactccggggattgctgagcagatgcggggctgcctggagctggcctggcccctggtg
ccctgctaatgccattttttggtaacacccattcacaatagcctggctgagggttttgtt
ctccttctctttatttgctatcactaaatccatctgattaaaaattagcctggtgtgccc

Exon  5 +      24530      24585   0    Initial     56    46    Marginal
ggctgtgaacaggagggtttggactgggaaccacgcagcacaaacgagctgagttcgagg
aaggcctcagtgccttgaaaggcagctgctgtttacacttttctcaagacagaggcttca
cgtggtcgccgttcacacaagtgccaagcaagaccctggcaccagaggcgtggactgaaa
ATGAAGCCACCTGAACGTCCTGTGACGGTCACGGAGCCGGTCGTGTTCGGGGGCCC
gtgtgtgtttgtcaggccaggaccctgccgcctgccctctggcttaaggaatccagttgg
ggagaaacactccctctgagtacccctggggttttgacccagcttgaggttgtaaacagg
tggagggggccgagtggagaggccttgctgtgatagagacctgggcctgccctgccaccg

Exon  6 +      25968      26004   2   Terminal     37    66    Marginal
accctctgaggcggccgtggagagtggcactcaggggctggctcaggtcccaggctgggt
gcgagctgatccgcgtcagcctctggttctgaaacactgagcctggctccattctgaaaa
gtgcagcagtaatttgaaccttgttctgaatggccccgctgattcatcctgcttttgcag
GGTCCTGCTGAAGGACAGCGGCTTCTGCTTCCTCTGA
tcctggcagcctggaacttcctgagaggactgggcatgtggatagccatggggggggacg
tcctttaaactggggaatgggctcccctagacacagtcgcttccacaggaatcttctaga
gcctcacccagggcagagcagacacccgcagcagcctggagttccggggagccctggccg

Exon  7 +      27084      27157   1   Terminal     74    64    Marginal
cgcagcatatagtttggtttctgtgggccgtgtgccttccatgtgcctggaggatggaca
ggtggttttgtaatgtgtgtcatagtttgcacccagctggttcaggtgttaagccaaaaa
caattaataaagcagtggtggtgatcagttcagacagagcccaacccctccccacgccag
GGGCTTATGCTCCGGAGCGGGAAGCGTGTTCTAAGTGGGACTTGGGTGTGAATTTCTACA
CCTACGCTAAGTAA
aatgggcatttatttacaaagctccgaattacattgttttatattttatgtttaaacttc
attaggaaaaattgccattattgttacacgtaatgagttgactgtcaatataaacgaagg
aaatgttggcaaaagaaaaattagacctatcatttttatttacaataatctcaaatgctg

Exon  8 +      27561      27754   0    Initial    194    54    Marginal
aagctaattttaagttttcaagaatgagaagttgtccccactgaaagcctggcacgttag
cgtctttctttgcgttagtttctctccattcttattttgctccgtggagatacggtgcgc
gcacacatattcaatattaaacacacatctgtaaacacacacaggaaacattaaacccat
ATGTTTCTATGTATTATTGAAAGTTCATCGGAAAAGACAGCAGAGGCCGTGTGCCGCTCT
GCCATGCGCCCATCCGGAGGCTGCCGTGTGCCGCTCTGCGATGTGCACCCATCCCAACAC
CCGGTCATCCTCTTCCTCCCACTCAGTGCCTGCGATTTCCTGCCGTGGCCCCAGAGGAAT
GGCAGCTCTTTAGG
gtcaggactgctcagctcagggcgggtgcaagacgctctgtgtgtcagagtcttgcactg
tggaatgcccgcttcctttcccccacgctgattcccccactgtgtagcttaccgtaatag
tttcacagctagctgacttccttaggccactggaatattgatttgttctcatgttctctt

Exon  9 +      29230      29698   2   Internal    469    60    Marginal
ctcctattctgaaggtgccattgagacgccaaatcttgtgcggttcaggcttttggctgt
ggttctccacggggtggctgatgagaggctttgtggccggcccactaggagggcatcgga
tgctcgccctgtaattgcgctgggtgtgcccgccaccggagttcccgcccctgatgacag
GGTCAGGCAGAGGCCGGTTCTTGCTAGCTGCAGGTTTTGTGGGTACAGGTCATGGGGTAT
GGGCTGTGGACTGAGCCTCTGGCCAGGGTGTGGTGGCATCTCAGGCCGCATCACCAGTGG
GTGTCTGTGGCTGGGGCAGTGTGGACGCATCGGGGGTGGGTGTCCGTGGCCGGCGGCAGT
GTGGACGCATCGGGGGTGGGTGTCCGTGGCCGGGGACAGCGTGGACGCATCAGGGGTGGG
TGTCCGTGGCCGTGGCAGTGTGGACGCATCAGGGGTGGGTGTCCGTGGCCGTGGCAGCGT
GGACGCATCGGGGGTGGGTGTCTGTGGCCAGGGCAGTGTGGACGCATCAGGGGTGGGTGT
CCGTGGCCGTGGCAGTGTGGACGCATCAGGGGTGGGTGTCCGTGGCCGTGACAGCGTGGA
CGCATCGGGGGTGGGTGTCCGTGGCCGTGGCAGCATGGACGCATCGGGG
gtgggtgtctgtggccgggggcagtgtgaacgcatcaggggtgggtgtctgtggccggcg
gcagtgtggacgcatcgggggtgggtgtccgtggctgtggcagcgtggacgcatcggggg
tgggtgtccgtggccggggcagtgtggacgcatcaggggtgggtgtctgtggccgggggc

Exon 10 +      29961      30057   0    Initial     97    45    Marginal
gggtgtccgtggctgtggcagcgtggacgcatcgggggtgggtgtccgtggccggggcag
tgtggacgcatcaggggtgggtgtctgtggccgggggcagtgtgaacgcatcaggggtgg
gtgtctgtggtcggcggcagtgtggacgcatcgggggtgggtgtccgtggctgtggcagc
ATGGACGCATCGGGGGTGGGTGTCTGTGGCCGTGGCAGTGTGGACGCATCGGGGGTGGTG
GTGCTGAGCCGAGACTCGGGCTCCGGTGTCATCAGGG
gtgggtgtctgtggccgggggcagtgtgaacgcatcaggggtgggtgtctgtggtcggcg
gcagtgtggacgcatcgggggtgggtgtccgtggctgtggcagcatggacgcatcggggg
tgggtgtctgtggccgtggcagtgtggacgcatcgggggtggtggtgctgagccgagact

Exon 11 +      30602      30696   1   Internal     95    59    Marginal
cgaagggccagggcagccttcactgtgctgaggctggctgtggtctcttgggcatctctc
ccgacttgggccaggtacacagtggggtagggcgaatgtgcacacatttccggtggactt
gggggagaccctctaggtctccttgaagcacagagccagtgcacctggcttctctgccag
ACACAGCAACAGTCACGGCCATTGGCCACAGCCACCTCCACGACAGCCACAGCTGCATTT
CTCCCCCTGGGGCCGGCTGCACCGGAGCTGCCCAC
gtgagtgtccttggctgacagcatcgcagcctcactcttaggggtgagcgagcagcaggg
gtggtttggttcagggaccccaactctgggagcccacctgcctggggctggactcaggcc
ccgtgttgccttgtgggtgggtgggtggcactgccggctgcgcccacggcgattatacag

Exon 12 +      38703      38778   0   Internal     76    94   Excellent
ccaaattattcaccaatggaggatgataggtagccaagtcattatttgaaaacccagtaa
ataaaagggaataatcaagcatttatcctgactttcctgtgtgaacttcactgatgggtt
actaaatagtaaattccgcttataaaattatttcatttcatgaattaaaatgaaaggtag
AATAATAGCATCACCTTTAACCCCCTACTAGAGCAGCAGATGAAGTACATACTGCATGGT
TCTGTTGAGCTGAGAT
gtaagaatagggtgactctagaactctgaagagtgctaagctttaggtggggcgggatat
gagaggagattctggagcgggggagcccgcgcctcggtctcggtactgactgtgtggctg
tgcacatatctaaacgtgtgagctctatttactgagtgtatattatagcccaacaaaatg

Exon 13 +      41436      41636   0     Single    201    67    Marginal
aactttggaaactatgcaaacacatggaaattaaacaacatgctcccgaatgaccagtgg
gtcagggaagaaattaagagggaaaatttaaaatttcttgaaacaaatgaaaatggaaac
ataacataccaaaacctatgggatacagcaaaagcagtgctaagagggacatttatagca
ATGAATGCCTATGTCATAGAAGTAGAAAGACTTCAAGTAAACAACCTAGTGATGCACCAC
AAGGAACTGGAAAATCAAGAAGCCAACCCCCAAATTAGTAGAAGGAAAGAAATAACAAAG
ATCCGAGCAGAAATGAATGAAATTGAGACAAAAGAGACAAAAGATCAACACAATGAAAAG
CTGATTTTTTTGAAAAGATAA
aattgacaaagctctagctagactaagaaaaaaaaaagataagaccccaataaataaaat
caaggatggaaaaagaaacattataactgatagcacagaaatacaaaggctcactagaga
ctattatgaacagctatacaccaatacattagaaaacctagagaaattttataaattcct

Exon 14 +      42080      42171   0    Initial     92    65    Marginal
aaagaaaaagcccaggccctgatggatcattcaaacatttaaagaactaataccaattat
attcaaactaatccaaacaaatggagagaaggggatacttccaaactcaagcagtgaggt
tagtgttacctgatacccaaaccagacaaggacacaacacaaaaagaaaactaaaggcca
ATGTCTCTGATGAACACAGACACAAAAGTCCTCAGCAAGACACCAGCAAGCAGATGCCAG
CAGCACATTAGAAAGACCATTCAGCATGACAG
gtgggactcatccaggaatgcagggatggtttaatacctgctcatcaataaatgtgatcg
gtcacatggatataacccagaacaaaaaccatgattatttcagtcagtgctggaaaagca
tttgatacaattcagcatccctcatgacaaaaactcaacagattgggtatagaggaacat

Exon 15 +      51486      51553   0    Initial     68    54    Marginal
tgtcagcattgttgccactgcccgttataagagactagggttccccaggctcaggccctg
ctcccaaggtgcagccgatatgtgtgcaggcatcactgggttcccaatcccaatttggta
ctgcgtgaggcaaaccagggcacctgcagacgctgcagctctggctctgctgttgcggtg
ATGTCCTTTGTCTCAGACGTGGACGTCTCTGGCCTCCTGCCTGCCCCTGTGAGACCCGCA
GCTCCCCG
gtgagtggggcgaggaggtaggggcatcttcacaccttctcagttctcagcagtaagtaa
tgcctctcagtcctggctgcacccagaaccacctgcaggctttctaatcaagacgaatgt
ctgttcttactgcctggagcccgtcctagtcaaagaatggcaatctctgggtggggtcca

Exon 16 +      52219      52337   0   Internal    119    79        Good
tttgcctcagtctcctggtggacacgtctctgtggaggagaggtcccctgtctgcaatcg
ccttctttcccatattttattacctgtttataagagtgagcacagttagaaccagctgac
agggtttggagtcgtgtttctcaggatattccagaggcattcctgctccattcatctcag
GACTTGAAGTATTTTCCCCAGCGGCTCATTGTAGACCAGCTGGATTCACAGGCAGTCAGA
ACCACGAGAGTGCATGTGCTGGTGGCCGTGGTCTGCGGACAGCATTTCCAGAGTGCTGG
gtgatgcggcccccgcgccttgagagttatactgcatcgggagactgggcagccctgggg
aggcccggcctggacaaccttctggctgacctggctccaaggccaggtctcctcctagac
gtttagggatcacttgggtctcgggacgcgtgagtctctggagtgacgtggcagcatctc

Exon 17 +      57726      58441   1   Terminal    716    52    Marginal
agccttcgagagctgctgtgtctcttgcttttgcagttcaggactttgaggcccagagag
gtagactgtgtgttgggggcactggcgggaaacggccgcaagcagtgagaccctgagagc
tgctccgtgtgggcagcagcgggtgctgctgggaacgcctgccggcgcctccacacgcag
AGATACGCGGCGCCGACACGGGAGGCTTCGTCCTGCCGGCGCCTCCACACCCAGAGATAC
GCGGCGCCGACACGGGAGGCTTCGTCCTGCCGGCGCCTCCACACGCAGAGATACGCGGCG
CGGACACGGGAGGCTTCGTCCTGCCGGCGCCTCCACACGTAGAGATACGCGGCGCCGACA
CGGGAGGCTTCGTCCTGCCGGCGCCTCCACACGCAGAGATACGCGGCGCGGACACGGGAG
GCTTCGTCCTGCCGGCGCCTCCACACCCAGAGATACGCGGCGCCGACACGGGCGGCTTCG
TCCTGCCGGCGCCTCCACACGCAGAGATACGCGGTGCGGACACGGGAGGCTTCGTCCTGC
CGGCGCCTCCACACGCAGAGATACGCGGTGCGGACACGGGAGGCTTCGTCCTGCCGGCGC
CTCCACACGCAGAGATACGCGGCGCGGACACGGGAGGCTTCGTCCTGCCGGCGCCTCCAC
ACCCAGAGATACGCGGCGCCGACACGGGAGGCTTCGTCCTGCCGGTGCCTCCACACGCAG
AGATACGCGGCGCGGACACGGGAGGCGTTGTCCAGACCCTGGGGCTTCTGCTCCTTCTCA
CAGTGCCTCAGGTTAATATTGTGGATGAAAAGTCTTTAAAAAGCTTCAAACTGAGTTTAT
CTCTGCCCTTTGGAGTTGCTGGCATGCCAGTTTGCAAACTGGCATCTTTGAAATGA
gccgactgccccatgtgagccatgacgtgtgcgcttgctgagttgacgcgaaacattcag
cgcggagtggcggaagtggggttctgagaaacttctactctgctcccgtttttgattttg
tttgtttcaacaagaataaggtgatgtggccctgagtggcgccagcaggagccttggtgt

Exon 18 +      59940      60016   0    Initial     77    62    Marginal
gacttgtggtggcaaaaaaaccaaggctttatagagagctagtgaatgcacacaagcaaa
ggctggaaacgtgtctgcgatgtagcagggaacaaacatttctacgctgctgatgatgta
tgtcgcttttactttttaggtgaagccaaaaaccttccctcttacccggggccgagcaag
ATGAGGGATTGCTACTGCACGGTGAACCTGGACCAGGAGGAGGTTTTCAGGACCAAAATT
GTGGAAAAGTCACTCTG
gtaatgtcttctgttgctttacttggcactgatgtgttttctttggtgtagagaatgtcc
caagggtgtacgtcaccttcccattttcccatgtgtggagaacgtcccgagcgtgtacgt
caccatcccgttttcccgcatgtagggaatttttctgtgcgtagacaatgtcccgagcgt

Exon 19 +      75435      75487   0    Initial     53    76        Good
aaatggtctctgtgttttccgtccggtctggtgaccacaagtcacgggctggtgagcacc
cgaggagctgaattctgtggtgggaatccaggttcgggagaggtcgtcaggcaggtgtgc
agacaacgtgagtggtgagcctcacgcccgaggaatccgctcttcctgctggacgcgtgg
ATGGTGGTGACGGCCTCGCCGCAGCAGCAGCACCTGGAGCTGGCCCCTGCCGG
gtgggtggtctccatggggctcatggcatctcgggggtcttggggggatgtcactctggt
gctccgtttgcaggtacaaacctgccattctaggagctgactgatgatcccggtcctcgc
ccctgtcctcacacccctgagtggtcaggcaggggcttcactcggctggttctggcctcc

Exon 20 +      78831      78928   1   Terminal     98    73        Good
acacaaacacgtgcctgtgggcacacacgtacaggcacatgcatgcacacacccacacac
atgcctgtgggcacacgcacccatgggcacacacgtgcacacacccatgggcacacacgt
gcacacacccacacacacatgcctgtgggcacacacacccctgggggtccctgacatcag
ATCTCGGCGGTGCCCACGCAGACGCAGGAGATCAGAGGATGGCTCGCTGCGTCAACGACC
AACGCGAGAATGTGTTTAAAGGAAACGTGACTTTCTAA
tgggccttcattaaccaggatgctgctacaatggagtcggtggaagtccctgagcattct
gccttcattgaaagataaagtgatgtttcttttgtgtgtaaatggatactgctgtgtttc
caaaatgcttaaaacaacctaggcattttaggcttcccttggaagattgttttatgacaa

Exon 21 +      81289      81393   0    Initial    105    47    Marginal
gtgagggcggctgggcagtcaggactttgtactggatctctggataaaaggagcggtcca
aggcactggagtgctgtgttttatgtttaatgcataaagggagccactgcctgccccaaa
ccaggtaccttcgaaacatcacgatggccctgaggctgcacctagacctgagcacgtagc
ATGGAAGTCATTCTGGCAGTGGCCGTGGTCTCTGTGGAGGTCTCAGCTTCCGGGCCGCCA
GGCAGCCCAGTACAGAAGTTCATCTGTGCAGTGCAAAGGCTCGAG
gtggaggccggggagcagctacgaggcccttcaccccacagggagctgcaggttcatgtc
tcatgcgtgccacacagtgcagggcattcttatggcatgtttaaaactaagaccacacgt
gtgtgccccgggggtgaggcgcaagcgtggcctgtgttctaactggcgcttttctttgtc

Exon 22 +      83413      83498   0    Initial     86    46    Marginal
ttgttcactgtacccaagtgattattcttagaaactgctgtgtttttcatagaagtctcc
agagtttgtttagaaaatacatggaatgggtcacatggatctcagataattgacatttga
cttcattttgagcgggaacactgtgctgggtgcttccgcagcggacaccctggccctgaa
ATGCGGCTGCAGAAGGTGTCTGAGTGCAGCGGGCACCTGACCCCCCTTCAGGGTCTTGCT
GTGCTGGGCTTCATGGAGCCTTGTCG
gtgagatggtcttgagggtccagcgtgacccctgcacccccttgctcagtgtctgcctgg
gaggccctcaggttcaggcccatagctttatgtcgcgttcaagctgggtgctgcggaagg
gttccctcttcctctctccctctgaccagggcatcggctccagggctagtggctggcagt

Exon 23 +      88325      88428   1   Internal    104    70        Good
atctgtatggcctttgttttttcctcgtggccctggctgggacacaggtggggtcagagg
gaggcgcgcgcatttcagccgcattccctgtctcgggcagctcttgctcagttgtgtcct
gtggctgtttcccctttttctggtccctctgcagctggtcccccgtctgatgccctccag
ACCCCTGGCTCCTCCTTTCTGAACGGGCCTGGCCAGCACAGATGCAGCAGAAGAAAGTGA
CCCTTCCGGCCTCTCGTGGTGAGAAGGCAGCCGCCTTTGCCCAA
gtgagaaagggaggcccagagtgttcggtaaacttttcggtgtgactcaaatagatgggg
acaaccctgtggattaggcacatcagagaaatttaagtagacgccgtggcttttagatca
ggcattctctcaggtcagcatctggagatacgaacacgcatgcttcaaatgtccacggtc

Exon 24 +      91333      91425   0    Initial     93    59    Marginal
ctcagaccctgtggctgcggacgctgcggtgaaccgggtctgcggggacccagagtttct
cacttcagtgactggaccaagatccttaaggagggcgtgtgtgtctctgggtgcagaacg
aagacgtgaggagtctgccaacatttccttcctcactcctgctctcgtgtgtgctctgtg
ATGGGCTCAGACTTCACATGTGTGTGCGACTCCCTAGGAGTTCACGTGCATCGGTCAACA
GAGGTGCATGTGCTGCCGTGGGTGCTCACCGTG
gtgggtggcgtggtccgcagtgtgcggaggccactggcagggttgacatggtggtgccat
gaagggacgcaggatgggagatggctcggtgcccagcgcctgacaagccctgtcctgccg
gggatgggatgggcacacgtttgccgcgcctcgggaatgtttctggaatgaggtgaacgt

Exon 25 +      92585      92819   2   Terminal    235    99   Excellent
ttattttttgtagagacaagttttcaccatatcgctcaggctggtctcaagcgaccctcc
cccctgggcctcccaagcgtgggggttccaggcatgagccccgcacccggccggtgcccc
attctgaattaaactgttggaaataagctgcggtgatgatgggctggcttctgctcacag
GCGTCCTGGCTCTGGGGCCTGTGCCCGTGGTGAAGTCTTCTCTGCTTGTGTTGCAGGGAA
GGTGGCCATCCAGAAGGAGGACTTGCAGAAGTACCACAACAGGGACACCTGGTTCCAGCT
GCAGCACGTGGACGCTGACTCGGAAGTGCAGGTGAGACTCTCGGCGCAGCCCCGGAAACC
AGAGCCCTGGGACACCATGGGGCTTCGAGACGGGCCCGGCTCCGACTGTGGCTAA
agacgtagatcgggcttcggccttgactgggaataacgatgagcagattgcgtgttcgcc
cacttgtgctcggagtgagcgcgggctccgccatggattttgggttgtgcgtgttcgcct
gcttgtgctcggagtgagcgcaggctctgccatggattttgggttgtgcatgttcgcccg

Exon 26 +      97289      97386   0    Initial     98    89        Good
ggcggaggttgctgtgagctgagatcgcgccattgcactccagcctgggcaacaagagtg
aaactccatctcaaaaaaagaagaagaagaagaaaaaaaaccccacaactccagtctcag
gagccgccgtttcatcataagatgtcacagtgaccattttcaggaaggcagggggtagcc
ATGTGGCTCCATGAGTCCCTCCGCTCTGTGATTCCCAGGAACAGTCCTGTGTCCGGACAG
CGAGTGTCACAGAAGCAGCCCATGGGGGAGGCCAGCAA
gtgagtcacagaaatgggggaaacacaattaaacctttcttgcttccttctggaacggcc
actgttggaaagtctttgttaaatcactttattatgcagagttgtgctctctgaccctcc
cctgatgcagggccagcgggggagacgccagcgtcagatgccagtgggggagatgccagc

Exon 27 +      97486      97612   2   Internal    127    96   Excellent
cctccgctctgtgattcccaggaacagtcctgtgtccggacagcgagtgtcacagaagca
gcccatgggggaggccagcaagtgagtcacagaaatgggggaaacacaattaaacctttc
ttgcttccttctggaacggccactgttggaaagtctttgttaaatcactttattatgcag
AGTTGTGCTCTCTGACCCTCCCCTGATGCAGGGCCAGCGGGGGAGACGCCAGCGTCAGAT
GCCAGTGGGGGAGATGCCAGCGTCAGATGCCAGCGAGGGCACCGCCTGTGACAGCGAGGC
ATCCGCG
gtgatctgggcgcctgggggtcactgagctccgtttataaaccaggctttcaagtgcatc
tgtgacgtattcagaaaatagcacagccctgcaggggatcacagcaaacccctgggtctg
ccatccgcccaagagacacctacgtgtttcccccttggagccttccagttgcaccgtgaa

Exon 28 +     103848     103924   0   Internal     77   100   Excellent
aggccacagctgggaccctgcgtcccgggggtggagtggaggggctggacgtgcccattg
gccagggcagggcggggccgcctgctccctttgccctctaggctttccctgggcgcgcgg
ccctagtggcctgtgggagcagcgccacagcctctgacaccccatccttgtgccttgcag
GGCAAAGTGCACCTGGAGCTGCGGCTGAGCGAGGTCATCACAGACACTGGGGTCGTCTGC
CACAAGCTCGCCACACG
gtaagacacgtcctcactagagaccgagcgcacagcgagtggcatgtctggctcccgagg
agcacacaggggttttcacaccaacgcacaagaatttccagagccggtggctgcccagga
tgacactgtttagaggtcctggcccaccaggatgatgctgttttaggggtcctggcccac

Exon 29 +     105764     105892   0   Internal    129    90   Excellent
aagcacatgctcaccttagaggtgttgttttgggcttttgtgaatggccagcgtgattca
gcgtcacaccgaggcagaatggctggtgtggccctccctgccttccggtgaggaaacctc
atctcacagcttgaactcaggcctcctgcctgacccagagctgtctcgccattcgcccag
GTGTCTGCGCTCCCTCCTGACGCCGCCTCTGCTTCTCTCCTCAGCATCGTCGAGTGCCAG
GGCCTCCCCATCGTGAATGGGCAATGTGACCCCTACGCCACCGTGACGCTGGCAGGACCC
TTCAGGCAA
gttgcctcacgcttcaggtttctgttctggtcctggggggctagggtccagctctgaaat
cacgagaccactgcctcatttgggaggagtcaggaggttgcgctttgaggtagaatgtga
atttttacttccttttgttttctttattgctccaaaattgctttgtagaaaatgaagcct

Exon 30 +     106274     106373   2   Terminal    100    93   Excellent
tttttggctgagtaaaggttcctgatttgcataccatctggagttggagaccagcagaaa
tatttataaaataaataaagccaataagtgacttgtgcatttgagagctcggttttacca
ctgagagacttggaatcagcagtgttgttttaatcccaatcctttctcacttgataacag
ATCAGAAGCAAAGAAGACGAAAGTGAAGAGGAAGACCAACAATCCCCAGTTCGATGAAGT
GTTTTATTTTGAGGTTGGTATCTTCATGGGTCAACGTTAA
gtggaaactctgcacccgagacacgttggcagaaagtctggatccagaatgatctcagtc
tcttccctctggaagttccttccggagaggagcgagccccgccagccggccctgggttcc
ttccggagaggagcgagccccgccggccggccctgggttccttccggagaggagcgagcc

Exon 31 +     109380     109456   0   Internal     77   100   Excellent
aatgctggcactcaggaagccaggcctgaatcccgaatcccgcctggcgccttcctggtt
gtggcccttgagtggtgtgtgggtaagcgcagagggtagggcagcccggggcctaggtcc
gcatatacccccgcctggtggcaccgcggtctcagcgctttctctctcgtctgactccag
GTGACCCGGCCCTGTAGCTACAGCAAGAAGTCCCACTTTGACTTTGAGGAGGAAGACGTG
GACAAGCTCGAAATCAG
gtgagaaaaccaggctccgcgtccccaacttggcagttttcacccaaactcctcagctct
tttgttctttgttactaaatatagggtcatagatagaaatgaatttccattttcttggta
attttcacaacaggatgttagaagttgtagttgaagtgacagcctgtgggtggtgttagg

Exon 32 +     112227     112331   2   Internal    105    59    Marginal
ccaaagccacaggctggtctgacgtgtttgaaacgtgccctgtgggctgagccttgatgg
agactctgggaggcgctgcaggctccattctgctcctgggggaacaaagcgtggcctgtc
atctttgctccacacgggctgcccgccgtcagctagagctgtcctgatgctgtttttcag
AGTTGACCTCTGGAATGCCAGTAACCTGAAGTTTGGAGATGAATTCCTGGGAGAACTAAG
GATCCCGTTGAAAGTCCTGCGGCAGTCCAGCTCCTACGAGGCGTG
gtaagatgatgttgcacctgcagacttccgcatctctgagagccacaaaaacacgtgctg
cctctgagtggaaaggcacagaggccacatgtgctggtcctcggctgtgcccagcaccca
cctgctcttactttgcatgtagctctgacgagctctggcttgatgagtttctgccccaca

Exon 33 +     112474     112515   2   Internal     42    78        Good
ttgaaagtcctgcggcagtccagctcctacgaggcgtggtaagatgatgttgcacctgca
gacttccgcatctctgagagccacaaaaacacgtgctgcctctgagtggaaaggcacaga
ggccacatgtgctggtcctcggctgtgcccagcacccacctgctcttactttgcatgtag
CTCTGACGAGCTCTGGCTTGATGAGTTTCTGCCCCACAGCAG
gtgagaaatggcaggtgaggagaggcagcagggatcacactgagcagggactcacaatgg
ctggcacctcaaaacaagacagggaacgtgggtgaaagcggccctaagccacgagcagct
cacggggtctgatcctgggtgaaagtgggaccctgagccgcgagcagctcgcagggtctg

Exon 34 +     114816     114994   2   Internal    179   100   Excellent
cccggtgaccagccctgctgggggtcttcggtggggagtccccaggggctgcactctgag
gggtcctacaggatcaccctcctgaccagtcgacctcaagcaggcagctgggcttccctg
agagctgctccttggcagatgcagcctcatgcctcccctccatgtgtccctcccacccag
GTACTTCCTCCAGCCCCGGGACAATGGTAGCAAGAGCCTAAAGCCAGACGACCTGGGCTC
CCTGCGGCTGAACGTGGTATACACGGAAGACCACGTGTTTTCTTCTGACTATTACAGCCC
TCTGCGGGACCTGCTGTTGAAGTCTGCGGATGTGGAGGTGCTTGTCCACGCCGTGGCCT
gtgggtgtgggcaggaggtgccacctgcctggggccccaccctacacccgggcccacccc
agagggcaccttctccctgagggggcctttcccacgcctcccagcctggcctgtttcccg
tccagatgcctggacccctttgctgggggcactggtccgtcgacagttagagccgtggga

Exon 35 +     115483     115631   0   Internal    149   100   Excellent
caagggtccagccaagcagcagcaaatgggaagtttggtgtttttgtgaatgtgtgtgtt
tctgtctcagcaaagagccgtatctattgtggctggaagtgagaccccagccaaggtggg
gacaggcctctggggttcctgcaccccgggccctggcactgacctcacccctccccgcag
CCCGTGTCAGCGTCTGCGGCCCACATCCTGGGCGAGGTTTGCCGGGAGAAGCAGGAGGCG
GCCGTCCCGCTGGTGCGGCTCTTCCTACACTATGGCAGGGTGGTGCCATTCATCAGTGCC
ATCGCCAGCGCGGAGGTGAAGCGGACCCA
gtgagtgcccaccctgccccgggggagagcggcctggacccgctacagggatggcaaggt
cgtcgccgagaaccacgtgtcctggggcagggcttgagggaattcaagggtccccagaaa
ccatgttgattcaggttttctttcacagacccagttaatgattcttttttttttttttga

Exon 36 +     116351     116498   2   Internal    148   100   Excellent
cggttccctctggcagtgttgacacaggacggttccatggccagggcctccaagcacctg
gcctggttgtgctccttgtaaaatgtcaggaagccgactgatgggcgtgcactgacctca
cagcccacaggcaggtgctcggggccaggctctgctccgtctgcacttccgcgtccccag
GAGACAAACGCTGTCCCCATCGCCATTTCCCAGGGACCCCAACACCATCTTCCGAGGAAA
CTCACTGGCGTCCAAGTGCATCGACGAGACCATGAAGCTGGCGGGGATGCATTACCTGCA
TGTCACCCTGAAGCCCGCCATCGAGGAG
gtgagcacggggccgagagtcctcagcctcacgaggcgtggggaggatttcccccaacag
agggcactgcactgggatccagccagaccacgagctgggcttgaatgtcggcccctctgg
cctcgccacggggatgctgattcattcacttttatcaagaggatgttccctgtgtactcc

Exon 37 +     118403     118526   0   Internal    124    99   Excellent
attgccacagctcccagcacagatttccagggagtggctgttcacacgtgtctcactgcc
gcagctgccctgcgcccgccctcagcccctccccacgcgcccctccctgggcgtgccctg
gtgctacacgcacctgtgggcagcctcgggagtgggtcccagtgccgtgtcccgttgcag
GAGAACCTACGGCAGTATGTGGACCGCGTCTTCCACGCCATCACTGAGTCTGGGGTGAGC
TGCCCGACCGTCATGTGTGACATCTTCTTCTCCCTCCGGGAGGCGGCGGCCAAGCGCTTC
CAGG
gtgagtgccctgaacaccctcatgttgctgagaaactgccatagcgctgtgcagggtgac
tcccacccaggcagaaccccccgcagccctggctagactagaactgcggggtcgtgaacc
ccagttccgatgctggatttttccggggtttgtgcccgggccagtgttccctagttcaca

Exon 38 +     120487     120630   1   Internal    144    65    Marginal
agagggaaacagagagagggagagagggaaacagagagagggagagagacagacacaggt
ggagatagagccaggactgtggctggacttccctgcggaccctcagggggccggggcatg
gtgtccccacgaggccattgtgcccgaggaaaacggtcaccctgcttctctctcccgcag
ATGACCCGGACGTCAGGTACACTGCAGTGAGCAGCTTCATCTTCCTGAGGTTCTTTGCGC
CCGCCATTCTCTCCCCCAACCTCTTCCAGCTCACGCCGCACCACACGGTGAGTGACCGGC
TGAGGGACCGAGGCTTTCTGAGCT
gtcctgcgacgccggcctgggttggggcatctgcgtggctgtagggggccgaccgtgtgg
agtgtggaatgcgtggggagtgtgtgaggaatcaggagtgagtggggagtgtgtgtggaa
tgaggagtgagtggggagtgtgtgtggaatggggagtgtttgtggaatgaggagtgtgtg

Exon 39 +     121668     121776   1   Internal    109    94   Excellent
gtgtacgttctgggggagtcgagacagtgtcacaaaagcagtggacggtttgtccagggt
tttagctgctggtcaccgccctgctctcctcccctgcccatcacatatggagtattgatg
atcggcgtatcatccgtgtattgagtcaacagattcctatttagcactgattttctccag
GCCCCAATGTGGTTGCTGGGGCCGCAGCTCTCAGGGTACAGGGATCTGGGGTGACCGTGT
TGCACGTGCGGGTGGCAGAGCTGGAAGGAGATGGCCAGGGCGAGAGGAC
gtgagggattgcccattccccagcacttctttttttttgagacagagtcttgctctgtca
ccaggctggcgtgcagtggtaccatctcagctcactgcaacctctgcctcctgggttcaa
gcaattctcgtgcgtcagcctccctagtagcttggattacagacgtgcgccaccacgccc

Exon 40 +     122487     122564   0   Internal     78    99   Excellent
tgagactgtgggacgcccaccccctccagtcccatctgcgtcgctacccctgtttctccg
tagctcatgcacaagccacagcagctctgaggtgactcctgcatttcgtcccctcgatct
gggacagtcacagcatttctgtgatgctgacatagacctttcttgctcccgcctccccag
GACCCCCAGACGTCCAGGACGCTGACATTGATCTCCAAGACCGTTCAGACCCTCGGCAGC
CTGTCCAAGTCCAAATCT
gtgagtccctcttcttcattttctctttttagggacaactgattcttttctctcttcaga
aaatacacgtgaaaaacctcccacatttgagagagtcgtaagataaagatcaagaatcaa
agccggcaccacatcctctcttgaaacccaggacctgagcgtccccgtcccgctcacctc

Exon 41 +     124271     124377   0   Internal    107    84        Good
cgatttatgtgattcgtcctccgggcagccctgcgggctctcacttgcccggtaacaccg
ggttctttgcctgtttatcgtcatttaggcttggacagttcttgcctctagctttttcag
atttgggccgtgagccgaggtacttcgggctgtcctcgagtgatctccgtttcattttag
GCGAGTTTTAAGGAGTCCTACATGGCTACATTTTATGAATTCTTCAATGAGCAGAAATAT
GCTGATGCGGTGAAGAACGTAAGTATCGACTCACCCTCCGACCGCCC
gtgtgccgtgctcaggagacggagttctcttttaaaattgagatagaacccacatgacac
agacttggccattagcgattttaaacaataaaggcgttcggtgcattcacagcgctgtcc
agacagccttgtcccaagtcctgggacacctcctcccacagttggtaaactctttggcgt

Exon 42 +     124823     125171   2   Internal    349    54    Marginal
tgtgtggtggccggactcactctaggctgcagtcgtggagccctggggctgcagactcag
tgtcaggaacgcggtgcgtggggaacatccagaccgcagggctctgctcctccccacagt
taggaacgcggtgcgtggggaacatccagaccgcagggctctgctcctccccacagtcag
GAACGCAGTGCGTGGGGAACATCCAGACCACAGGGCTCTGCTCCTCCCCACAGTCAGGAA
CGCGGTGCGTGGGGAACGTCCAGACCGCAGGGCTCTGCTCCTCCCCACAGTCAGGAACGC
GGTGCGTGGGGAACGTCCAGACCGCAGGGCTCTGCTCCTCCCCACAGTCAGGAACGCGGT
GCGTGGGGAACGTCCAGACCGCAGGGCTCTGCTCCTCCCCACAGTCAGGAACGCGGTGCG
TGGGGAACGTCCAGACCGCAGGGCTCTGCTCCTCCCCACAGTCAGGAACGCGGTGCGTGG
GGAACGTCCAGACCGCAGGGCTCTGCTCCTCCCCACAGTCAGGAACGCG
gtgcgtggggggaatatccaggccccagggctctgctcctccccacagtcaggaacgcgg
tgcgtgggggcaacctccaggccccagggctctgctcctccccacagtcaggaacgcggt
gcgtggggaacgtccagaccgcagggctctgctcctccccacagtcaggaacgcggtgcg

Exon 43 +     132803     132909   2   Internal    107   100   Excellent
tttcaaaggagaggcattgccttccaattttaatctcatcactcggagtaaaatgataag
atattgaaaatccactgcctgcctcaggtctcagaacgcagaaagtggggggtgtggttt
ttcacctgtgcagggaggcagctgaggcccggaccccggccctgtgtgctcttcacacag
GTTCATGATCAAGAGGGCCCAAGGACGGAAGCGCTTTGGGATGAAGAATTTTAAGAAGAG
ATGGTTTCGCTTGACCAACCATGAATTTACCTACCACAAAAGCAAAG
gtaaggagcaaggtcgctttccctggctcttgctggagcgtgctgggccctgggactgag
tctgctttttcagggggagagctgaggggaggaaggattcagtgctgcgggcagagcccg
gggccgcggtgacccagagccctctgcttctggttctcccttcaaagatccctgaagggg

Exon 44 +     134068     134150   1   Internal     83   100   Excellent
ccccggtagagaccccctggcagagaccccctggcagagaccccccggtagagaccccct
ggcagagaccccccggtaaagaccccctgggagaccccccggcagagacccctcagcccc
acccggaccccagccgggacagcggggcccgcacccactgacagtccatctctgctgcag
GGGACCAGCCTCTCTACAGCATTCCCATCGAGAACATCCTGGCAGTGGAGAAGCTGGAGG
AGGAGTCTTTCAAAATGAAAAAC
gtgagtgtggggcccccaagcctctctttcgggttgaggcctggccaggttttctctgct
ctcttcccgtacctggccctgggctcacccttccccacccactgcactccaggcttctca
gagtcttcgtgttactcgggttgttcaccaggtgctggtgagtttgtgtcggaatctcgc

Exon 45 +     134302     134391   1   Internal     90    92   Excellent
tggaggaggagtctttcaaaatgaaaaacgtgagtgtggggcccccaagcctctctttcg
ggttgaggcctggccaggttttctctgctctcttcccgtacctggccctgggctcaccct
tccccacccactgcactccaggcttctcagagtcttcgtgttactcgggttgttcaccag
GTGCTGGTGAGTTTGTGTCGGAATCTCGCATCAAAGCAGCCACACTCTCTGTGCCCGGGG
TCACCGGGGTGGGGTGGAACCTGCCGGAAG
gtggggcctgagctgcttcaggtggcgtcccccgcagggtccccaatgtcaaggggccct
ctgtcaaagacatcccagaagcaggcttgggaccgtctggaattccttttggaagctttt
ttattttgatataattttgaatttatagaagttgcacgagtagaacaagtactttccaca

Exon 46 +     136996     137153   0   Internal    158    99   Excellent
ccatgcaccccctggccttggcctcttctggggcttagagctccaggacttttgggcctg
tgcaccctcagcgtcccctcttacgactccggcgaggacggccaggtgcctggtggactc
ttgcacgtgctcagccacgagacctcatgtgcgctgtcctgagcccacctgtgtcctcag
ATGTTCCAGGTCATCCAGCCAGAGCGTGCGCTGTACATCCAGGCCAACAACTGCGTGGAG
GCCAAGGACTGGATCGACATTCTCACCAAAGTGAGCCAGTGCAACCAGAAGCGCCTCACC
GTCTACCACCCGTCCGCCTACCTGAGCGGCCACTGGCT
gtgctgtagggcgccatccgactcggctccgggctgctcgccctgcactgggtaggtctg
tgcctcggtgcccagctcgtgcactgtgcaggaaatgtggccaaggggctgagtagggag
ggaccagcagacagtgcatgcctgcctgtaagctgcacataaacagggctgccctcgcct

Exon 47 +     141147     141340   2   Internal    194   100   Excellent
ccttgctcagcaagccaacacaccggctgtgcacagacggacagcaaatcgatcctgtcg
aatttcacttccaacacaatcgttgtctttcttcagtgacattttaaaaatgaatgtcat
tattaaaagcatcgtttaaataagtgtttttatctttctgttcttgctgtgtctggacag
CGGCCTCCCAGCCAACATCCAGCTGGACATTGATGGGGACCGTGAGACGGAGCGTATCTA
CTCCCTCTTCAACTTGTACATGAGCAAGCTGGAGAAGATGCAGGGTGAGTCTGCCCGGCA
CACAGATCTGTGCAGCGAGGGGATGGCTGGCGAGGCCCCGGCCTCAGGAGCATGCTGTGG
GGTGAAAACCTGTG
gtctgagcctctggtgtagtgtgggctacatgtagttgtctttgtagcacggatggatgc
gaaaagctttttgcagggtaggcagctatctgggggacaattacctgtataataggttct
atagataatttttagatggaatttaacttgtaacctctgtactgccaagtttctttagag

Exon 48 +     147942     148125   1   Internal    184    99   Excellent
cctacctgcgggaatggtttctatctccgtctgcgtttacgagtggtggtcagccctttc
tggaggagcttgcgttggaaggatgtgtactgtgggtggggcctgcagcgacgcagctgt
gtggagacggggccggtggcctgggctcctgccctgcgctgacccctccgccctccacag
AGGCCTGTGGGAGCAAATCTGTGTATGACGGCCCGGAGCAGGAGGAGTATTCGACGTTCG
TCATTGACGACCCCCAGGAGACCTACAAGACGCTAAAGCAAGTCATCGCTGGGGTTGGGG
CTTTGGAGCAGGAGCACGCCCAGTATAAGAGGGACAAGTTCAAGAAGACGAAATATGGAA
GCCA
gtgagtgccactcccgtgcctgccctggacggccagtgtagtgggcgggagattgcagtg
ggggtggggctgcagggagctcccgggtggggccgcccgtgctcaggtgtccgcctggga
ggagagtcccacttgcaccgggctggcacctggcggtagtcagtggacgtggcccggcgc

Exon 49 +     150378     150453   2   Terminal     76    90   Excellent
acacatcagagtcaccgtgggtgcttccgggggcactgtggttcctttggctcctctatt
ttttgtgtggattgcagtgtgagtgtgtcacatttaggaacaggaaaagctcccgcagcc
acgggtgagcaccaggcaacggggtctgtgcctcattccctctcccatcccccttttcag
GGAGCACCCCATCGGAGACAAGAGCTTCCAGAACTACATCCGGCAGCAGTCCGAGACCTC
CACTCATTCCATTTAA
agtctgcgggacgcgcccagtggcgccagcaagctgcccatgcaaagccgcagcctttgg
gagggagaagagaaggaagagcgcagagccggcaaagtgagatgcacgccgtcccggccc
atagacaagtggcgctggggtttccctctcccagaaccgctgccaccaccgccacgccct

Exon 50 +     150493     150549   0    Initial     57    41    Marginal
cagccacgggtgagcaccaggcaacggggtctgtgcctcattccctctcccatccccctt
ttcagggagcaccccatcggagacaagagcttccagaactacatccggcagcagtccgag
acctccactcattccatttaaagtctgcgggacgcgcccagtggcgccagcaagctgccc
ATGCAAAGCCGCAGCCTTTGGGAGGGAGAAGAGAAGGAAGAGCGCAGAGCCGGCAAA
gtgagatgcacgccgtcccggcccatagacaagtggcgctggggtttccctctcccagaa
ccgctgccaccaccgccacgccctccgcagaaagcccacctggccctgtggaacgtgtcg
tcatttgattctgtgctttttgctccttgtttgtggggatctggggatcagctgaaggat

--------------------------------------------------------------------------------