--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (36168 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1450       1584   0    Initial    135    94   Excellent
gccgctgctccctcagttgccgccgccgccgccggcgcccagggggccgccgcggctgtg
aggtgggggcggcagcgggaggcggcggggcgggccgccggggccggggctgggggcgca
gcgcggccggcgtaggtctatgtcgcgggcggcggcggcggcggcggccgcggagggacg
ATGCGCGAGTACAAAGTGGTGGTGCTGGGCTCGGGCGGGGTAGGCAAATCCGCCCTGACC
GTGCAGTTCGTGACCGGCACCTTCATCGAGAAATACGACCCCACCATCGAGGACTTCTAC
CGCAAGGAGATCGAG
gtggattcgtcgccgtcggtgctggagatcctggacacggcgggcaccgagcagttcgcg
tccatgcgggacctgtacatcaagaacggccagggcttcatcctcgtctacagcctcgtc
aaccagcagagcttccaggacatcaagcccatgcgggaccagatcatccgcgtgaagcgg

Exon  2 +       5911       6038   1   Terminal    128    47    Marginal
atttgtgtgataatttatgggtagccagcctttctcacaaaactccaagcccacgtaggt
gacacagctcctactagcacataggaaacaagaaaaaatgttgaaaaaatgaatgttcag
aaagaaaagtatttgtattgttgtttggcctcagtttccctaaacattttgatttcatag
ATGGAGGAGATGATCTTTTAAAGTTCATTTTGCAGATGGAGATGATCTTCCTTCAGCTCG
AACTTTCTGTGAGAACACTTCCAGTTGGGGCAGTGTTTAATACGAACCTCAAAGAATCAG
AAACATGA
tgtattccagatggaggaaatggcacaggaaatgcatagaatatgttttttggatgttaa
atagagcagactggccaaatggggaatgtatatagaagtgtgaggggaggtaaggtgaaa
atttttaaagctaaattactgaaggttaaagacttaggagttgatcatgtagtcaaggac

Exon  3 +       7042       7094   0   Internal     53    67    Marginal
ggtgagtaagttgtttttttttaagattattattaattttctatatcacttaagtggtca
ctttcaagtgagctggctgattgtttacactttcccccttaccataagtagctattaaag
cctactctaaaacagaagcatattaccaattgttacacatagatctttggcccatgacag
TTTGGTGCTGGAGAGCCGAAACGAGAGTATACATCAAAAGATGTCTGTCCCAA
gtaagtgaaacttctggagctctgctaccgtttttccctctaaaaatacctgcttcccca
gtaccaaaacttaattcaaagctggacctcccaggtacagagcctaatagctgtgggtca
ctttttttttgttttgttttggtactggtgaattagtaggaaaaatttttaataataaat

Exon  4 +      11971      12129   0     Single    159    41    Marginal
actaatgacaacaattgtatatttatatataatcgcctttttgtatatgtcttagtctct
tcaggctgctataacaaaattccttcgactgtgtaatttataaacaatagaaatgtattg
ctgacagttctagatgccaggaaatccaaagtcaagacaccagcaaaattcgtgtcacaa
ATGGTGCCTCTTGCTGCATCTTCATATGGTGTAAAGGGCAAAATGGCTCCCACAAACCTC
CTTTATAAGGGCACTAATCCCATTCATGAGGGTGGAGCCATCATGACCGAATCACTTCCT
AAAGTCCCCACCTCTTCATTCTATCACATTGGGGATTAA
atttcaacatatgaattttagggagacaagcattcagaccacagcagtatatttagtaca
tttttatcctccctatctaaaatataatttctccttccctcaatgatccacttacactcc
actgctttctttttctacttcgtgaaccaacagtcccaacaaactttgacaatcagtaat

Exon  5 +      25042      25078   2   Terminal     37    58    Marginal
acctatatcatgttggagaaaagatttctacattctaaagggtaaaagaactagaatcta
tgagaagaaggggcagggtgttacagatcacagttccttatatacaagtaaacttttaaa
ctgtgactttttaacactaacatttaacagacctgacagtacaaaatgggttgcctgtag
GTATGAGTTCCACGTCACTAAAAATGTTCAGACGTAA
gctccaaagccatttggtaagtttatcatggaagtaattgaagcatcagtttttttgacg
ttttgccttgggactctcttggtagatgattttaactgtgtgaaaagatgaatgagggga
cttagaaaagcctttctgattctcatttccaaattcaaagagaattatatttcaacctgc

Exon  6 +      27777      27825   0   Internal     49    94   Excellent
ccttcagcgtctcacccatctttcttaaggaggatccagatttctccaaatgttaccttc
atatgggaccctattctgtcaccccaatccagagccttcttagaatgcctttcccacagg
ggccagtatattctctcgagtgcccgctgtttgggaatgcttgcttttctgctttcctag
GCCCCCATCACCATGGATGTTCAGCACAGGGACTCTGGAGAAGCACCTG
gttagtgtctggtggctgctttgttgtttttgactcccatcttttttgcctgtctcttcc
tccagcttcaccctcaactcggtttgccctcaggagttctttacctcctttgatcagttt
ctccggctccttcttcaccctttgtggcttctcaaggccacatcactagagttaggaggg

Exon  7 +      31184      31421   2   Terminal    238   100   Excellent
tgtgagagcagcttcaaatgccctcagatctaagtatcaagccaagtggtacaaatcatt
ttcatgcaactgaagataccatttatgttggaatagcccccaaaaacgaaaatacacgtg
acctgtttaactttgtgctaactgttacaatgtatgtgtgttttgtttattctctcatag
GTATGAGAAAGTGCCAGTCATCTTGGTTGGGAACAAAGTGGACCTGGAAAGTGAGAGAGA
AGTATCGTCCAGCGAAGGCAGAGCCCTTGCTGAAGAGTGGGGCTGCCCCTTTATGGAAAC
TTCCGCTAAGAGTAAAACAATGGTGGACGAACTCTTTGCAGAAATTGTGAGGCAGATGAA
CTATGCTGCTCAGCCTGACAAAGATGACCCATGCTGTTCTGCATGTAACATACAATAG
catccaaatatggctgtcctggatgggatttgcccaatgtcgtaggtgatagaaaactcg
cctactccactgcagaacttgcagaatgcgtggtgttaatctacagagaactgcagccct
tattcagaattgagcagtgattgtcagttgatatctctgagtaacatttgggttcagtaa

Exon  8 +      33782      33862   0    Initial     81    64    Marginal
cattatggcttgctatgcagatgtgaaaataggttaaataatatgaaagatatggcagaa
tgtaaagtggaaaagatgacctaaaattttgagttgtattaatagttaaaaacatttgtg
tcagatgacagggtgggcttttactgtcaagacatgaataagaactgatctggctgcctg
ATGAGTGTTTCCACGCAGCCCTGCATATTTAGTGACCAAGGCATCAAGGACATCCCGAAA
CTGGAAATTCATATCCATCTG
gtatgaatatataactcagctggcaaatgaatgtgtttgttgagatattacagtaataaa
acacttaagaacaggaagattacatttgttggcatacgaaaccttagtggctacagaaga
aagttgaccttgtgtcactatttattttatgccctgatcagactagcaacttagataagt

Exon  9 +      35307      35408   0     Single    102    47    Marginal
ttttcatagtctttaaaaataaaaataacatgtaagagactgtaaaatcagttattataa
atataaacttatctctacaaatgattttatattttgaatggtagctggttaatttaaagc
ctgatgctaaggttaacagaattgttcaaataattaacattaattagcaatatcactaaa
ATGATTCAGAGGCCTTCTAGTGATGGCTTGAAGCCGTCTTTCTGTTTTCAGGTCATGTGG
ATCCGAAGGTGCCAGAAGCTGAAGGTTGCCGCCAGGCTGTAG
ggcctgcttgttctatatggggccctatgaaagttgacagatgctgttaattgtatacag
ccttcagctgctctgataaggagcccattcatttcctaagccaatttaaactatgccttt
tggttatgttgccttcaaactctgttgaaatcctctggcagcattccaccagttgagaag

--------------------------------------------------------------------------------