--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (174161 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (39 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       4322       4435   0    Initial    114    58    Marginal
attttctcttccttttttcctgtactttcctaccgataacaagaaaaagatgaaaaggaa
ggtatactgatttgtttacatttccaaaatgacaaaacagattatcaacatagaaatagg
ttggcaacattgcaaggggtgaaggattctgattcgggaaaaggtggataactacaagac
ATGTTGGTTGTTGAAAACATAGTTTTGGGGGCCTTTACCATCTTCAGGTACAGCTACATG
TCAGAGCTGGCTGGGTTGTGCCAAGCAGAGAAACCTGGCAACTCTAGGGGGCAG
gtgggcagtggagataaagggggttataaaaaggtagggaggtgtgggcataaaaatcaa
caagcaagaaagcccagagagagctgcaggtcaagagtcaggccaggcaagcacagatcc
ctggggcatggcagaacaggagaggacagttcgccctgttcacgaaatctgctcaagacc

Exon  2 +       4912       5061   1   Internal    150    69    Marginal
actgctggggagagcaaagagcttgatattttaatgctttggtttctctcagaagaatga
ggcaggaagacttaaccgggctttgtaaattagttaacatactatttttttttctccagt
tttatactcttctcagttttttttttcttttaaaaaatgtgcacaaactatttgttgcag
CCGTGATAATATTCGTAGTAAAGAGCCAAAGGTGCTGCGTGGCTGGGTCTGCATCAGGCC
TGGGCCTCCGACTGCACGGCTCCAACTACACAGTTGTTTATGGAGACCAGTCCCGGCCTC
CTCTGCTGAGAGTAAAAACAGGTGTGAAAG
gtaaggcctaagggtttcttttgtaaacctgagctctgaggctgatggacgagttttggg
ctggcctgccctcctcaatacagcagaaacgcttggtaataaaagtggactcaataattt
accttagtgttttgacaaagaatgcattgtctgaattatactaggtagtatattccatca

Exon  3 +      10206      10283   2   Internal     78    91   Excellent
tgagaaagtacttgaagtatgcaaatagattgatgccgtcacaccagacacctaccataa
gtaaccagacagcacttctcaaactctcatgtgcctgcgaatcacctggggatctcatta
aaaatgtagactctgattcagtagggctgggctgaggtcaagattctacatttgtaacag
GCTCCAGGTGATAAAGCTGATGTTCATCCAGGAGGCTCCAGAATACAATAGCTGCTTTGG
AAGTGTCACTGCCACAAT
gtgagtggcagcagatcactgggtctgggatggctccttggaggatcttctggcagtctg
gagactgggacctacctcctccacacagcaggtctttccaggctgttcagcctcagagtg
aagctgaggttgaactgatatatcccaccagccttgcaccaatgtggctggggctgaagg

Exon  4 +      11234      11357   2   Terminal    124    82        Good
tcctccctcctttcagatgccttgttttcctgtgtgtcccacatgtggccccctctttcc
tagaaccaggagtcaagctaaactgatttagaggaagtgttccctacccagatgctcatt
tagtccacacacagatggccggtatttttatgcatttttaatttaccaataaccttttag
GAATGAAACAGAACTAACATTTATTGAATTTATTGAGCACTTACTATATGGAAAGTCCTC
CTCTGCTGATAGCTTCCTGTATATCAACTCAGTTAAACCTTTTCATGAAGAAAATGAAGC
TTAG
agagaccaagttacttgccaaggttacagaataaggggtaaaactcaagatggtaggatg
gaaacatgcaacccttgtccaccagttcttacttggggattgcagcaaaaagggtttgct
ttagaaaaacttccccgacagttgtaagtactgttagtggagctcactaaatagttaaat

Exon  5 +      13839      13916   1   Internal     78    70        Good
atgtgttttggttcaacgagcattttcgcagtagcgctcagtcctcccgagtttctctgc
ggctctcagcagcttagagacacacttcgccatcagtaggtgccaaggtcactggaggaa
ctaattaatcccagctccagtcaacagcaggctgcactaacctgccctccttcctcgtag
AAGGAGAAACCAGGAAGGATTTTCTCCCTCAGTTCCGCCCAGGCCTTCTTAGGGACACGC
AGAGCAAACAAAGGAAGG
gtgaggaggggtgttgaaccatttctctatgaggtgaccacattttcatgtagagaaggc
ccagagcttgatctgaagctttcagacttgagttgatatttaacgtagagatccccaggc
ccctactctatcacaaactctgtctttttttttcctctgtactagtattagttttattaa

Exon  6 +      14489      14636   0    Initial    148    48    Marginal
gatacaaagttagaaaacattgccatttaaaaccttgtagataccggaattcttgtgagt
ccccttatccaggtacatgttaggtcttgagttaattgctctgtggctgtggatttttat
ttgatgttctgatctcttccttccagtttgataaattagtgtagaaagtggaagaaaaac
ATGCCGGCGCAGCCTGTGCGCTTTGTCAGGTTAACAGAATGGAGTCCTGCTCTGGCATCA
GTCAGTGCTGTTGTCCGAACCCTCTGTGGCTCCTTCCTCCCTCCCTGGGGCCCAGAGCTG
CAGACGCTAGAGGGGCATCGGCCTGGGA
gtgaggttcccgctacagtttggagaacccagcaaatcctggagttaggtttctgacgct
ccccatcttgctccctagttacaaacagaaaaaaaaaaaaatcaaaaccatatgttcaat
acactgtcagccttctagtgaacatgttaccgttaaataataaccgtcagcctatccgca

Exon  7 +      18410      18551   0    Initial    142    76        Good
gtggaatacttgtgaatggctgaagtgttttagtattgaggcaggcatttctctagataa
ttattagctatgagtcatactcacagaaatccatagtccatcatctatacaaatataccc
agaagtttatatggtgatgaaaaatgaatgcattttccccctgggaacatatgcatctct
ATGAAGTTGTGCTTTAGTGCTAAAGAGAGGCCAGCTATGCTCCAATCCCTTCAACCAGGG
ATCTTTTTTCATTTAAACTTCAAAGAAGTTTGGCTGATGAAGGCTGTGGACAGAGAGAAA
CTAAGTGTGAGATACGTGAACT
gtgagttctctggagcgtcctaactcttaaaataagttttagctgcttgagtgctgtagg
atagatacttctggttatgtgtggctgcacaaaatgtacagcacgtctgacaaaatggat
tgacctatttctttgcccttgagggccactcgaaaacttaataaaagacaagcacatcta

Exon  8 +      38023      38465   0   Internal    443    52    Marginal
tgtgactcaaaaatgcagtctttccttgtgagagaataccagagccaaggaatggggcct
cttggagcttagccttaatgagaatcatgttcacatcttctcagactctgagcaatcttt
tctgctgatggccttcaggacccagcactgcccccattcaagttagagacccttttctag
GTCCAGGACCGCAGTATCTCCCACCACCACATCATGAAGACTGGGCTTGGGTGTGCTGGT
GAAGTCTTGGTGCACAGTGGCATTCTCTATATATTCTGTGCTAGGAGAAGAGAACATGTA
AAGAAGAAGAATAAAACCTCTGGGGCACCAAGTCCCCCAGCTTTTGTCCTTTTCACAGTC
CGGGGCATAAGCATTCCAAATCTACCTCCCCAGTCCTCTTCACCCCTGCACCGACTCCTC
AAGGCGCTGAGTGCTACAGGCAGAACCTGCCACCTTTTCACCCTCCCTGAATCCCCTTTT
GTGCTCCCTCCTTGGTTCTGGACTTGGGAGCAGGAAGAAAATGGGCTCCATGCATGTCCC
CCTTCCCCCGATTCAGATGCTCCTTTTAGATCCCACGGCTCAAAAGGCCTGCTGACAAAT
CTAGGCCAAACTCAGCCGAGCTG
gtaagatttccagaagagttcctaaaaatacacttctccttaaatcagccttgccaatca
ctgtacaatcacagaactttaaggacagaagtggctctagaaattgttggggcctctctg
ttttaaagctaagaaactggagtcctagcgtgctgaaataatagcaacaacagcggttga

Exon  9 +      39088      39165   0    Initial     78    72        Good
taaataatgataaggactttggagggaaataaagcacggtgagtcagagtaaggaggtaa
gactgatgcaatattacatcaggaaagactgccccataggctgacctccaagctatgtga
ctatctgggacaaaagtattcccagcagagggaacagcgaggtcaaagctctaaggcagg
ATGTCCCTGGCTACTGAAGGAGCAGTCAAAGGCCAGGATGGTTGGGGGGAGTCAGAAAGT
ATGGGGCCAGTCACCGAG
gtcagtgtaggccgtcagaagactcttgacagtcccgctctgtgaggtggggagccattg
gaggttcctgggcagaaatgtgacatgatctgattacattttcaaagagtccctcaggat
gatttattgagatgtggctgcagtgcggcaagggtagaggcatcagtagactggtgagga

Exon 10 +      41099      41254   0   Terminal    156    65    Marginal
gcacccttaaaactctctttacaaacctgaggttccaaaagggtagctgctcaggatccc
gcaggcaccaaagcatctctgacttcagagcagagagtgcaatccctgccttgccgccac
actgttcttgcagcagcaagtgctccaaattctccaggcactgagtgcctccttccccag
CTCCAACAGCGTCATGTCACAGAAACCACCCCCTTGAAAGCCAGCAGGGACTTCCCCTTC
GTGACACCTAGCCACCACAAATTGTCCACATGCCTTGATCTCTCCGTGGCAGTGGCAGTG
GACGCTTTTCGCTACTCCCTCCTCTTGAAACTCTGA
acctttctccctcactgttgcattattggaaggatcttttgtcgctttctttttctgtgg
tttgccttactcctcttccttctttcacctccaaatcactaaagaaactgttcttgatcc
agtccaagccttcctgttttctgtcctagatgtatacaaataaatcccttctccctctct

Exon 11 +      42144      42267   2   Terminal    124    47    Marginal
cacgcctcattcccaatccccaaagatgaatttgcttctaatgaattgacctcagcagta
acacctccgttttgttctcaccactgcagtgtaatttttgacctttctgctctaccatgg
ctgtaacctttaaccaatttcccctcccctgccaaccttttcaattctaatgtatcctag
GTGGTGCTTCCAGAAAGAGCTTCCTCCAGCTGGGAATCTTGTCAAGATCCTGCCAGTGTT
CCCCACTGTCTACTATACTAACTATGCTGATGTGTTACACCTGGGCCTACTTAGTGATAC
TTAG
gcagacaaagcccctatgtcactattcataatgaggaccacactaccctgagggacatgg
tggaaacttaaaggaccatttttaaaaaaattgtccaaatgcctggggggcatctctgga
atttaatggacaggagtacaggattttgatgtcttgcaatggacgtgactcccttggagc

Exon 12 +      47279      47402   0    Initial    124    50    Marginal
cacgcccggctaaatttttttctattttttgtagacatggggtttcaccatgctttccag
gctggtctggaactcctgacttcaaatgatccatctgcctcggcctcccaaacgctggga
ttacaggtgtgagccactgcgccgggccgagagtgtgcattcctaacaagatcccagcgg
ATGCTGCTGCTGCTGGCCCAGGCACAACACTTTAAAAACCGCTGGACTAAAGATCTGGGC
ATTGAGGCTCACGGTGTGCATCCCTGGGGCAGCTCCCAGCCTCAACCTACCTGGCAGCCG
CAGG
gtaagccagtggcatctgctggaattttcctacagataatactggaattccccattcaga
gcattagtcctttagcttagactttggttcttattaaaatgcaaatattccttggaggag
gatcaggagctcattcaacaaacatttgtccagtatattctgcataccaggcactgaact

Exon 13 +      48843      48892   2   Internal     50    64    Marginal
tgctctcagactctgtggctggagcagatctacaccaggtctaatcctggtcatcatatg
gaactatcgtagagagagaggaagcctgaaagtagattttgttaatacagattggtatag
taacttttaaaaatcacagaatacttttatatttccactataatctgtctttcatggcag
CAACCATGTACATACAGGCAGGAACTATTATCGACATTTAGATGAAGAAG
gtgggtctcaaagaaattgacttgcccaaggttatgtgacgagataccttggcaaagtga
aggctggaagctagttcttaggactttctatcaccctggaagttctgttgactaatagaa
gaaatgcaaaagcccttgagacagcaccgtcagtagcaatagaatgtgagctacttagac

Exon 14 +      55082      55255   0    Initial    174    65    Marginal
gattgcctgtccatacactctctcatcatcctgttccttggattggacttcactaagcaa
tttatcactcaccttcagacttacatgtgggagttttcacaacagtagttttggaatcat
tagaacttggattgatttcatcatttaacagaaacaaacagcccaaattactttatcacc
ATGGCTTTGAACGTTGCCCCAGTCAGAGATACAAAATGGCTGACATTAGAAGTCTGCAGA
CAGTTTCAAAGAGGAACATGCTCACGCTCTGATGAAGAATGCAAATTTGCTCATCCCCCC
AAAAGTTGTCAGGTTGAAAATGGAAGAGTAATTGCCTGCTTTGATTCCCTAAAG
gtaagagaatgcgttttatgtgtcatttcaataccacattggaattgcaaacagaaggct
tttcattgcatttttacagaagtttaaaaattgcttttagattctattttcttgtttgtg
gtgactgttgggagatttttcactcaaattttttcatatcaggcatatataaatttttta

Exon 15 +      57808      57983   1   Terminal    176    61    Marginal
aatttcaggttatttaatttgagtgcaacattacacatttttaaaactgtccaactgaaa
agaatgtgaaaacggcccacaggcacaggagtaaaatagacctgagtctaaatacctgct
caaccacttcccagccttgggtgtgtcatttatgacttcttgacttggtttcctcatcag
TAAAAGGAGGATATTCAGCAGAGAAATTGGCTGAAGTAAGCACGGTCTGTAGCAACACGC
TGGCATATTCACATTACGAGGTTCTTGTGAGGATTGCAAGCTGTTTCCACAGGACAGACC
AAAAAATAGTAGCTAAAAAGAAAAATAATGACAATGATAATTATGAAGCTGTTTAA
ctttatttcataatagattttaaaaagacaatgttgctcagtgtgcaacagagagaacca
gtgtgcaatacagagaagcagcaagggctttgaaatcagaaggaccagggcttgactaag
cctggctgggacctaggcaagcttcattacttgggacgagttattttacctcgttggctt

Exon 16 +      85096      85343   0   Internal    248    49    Marginal
ttctctcttcacacaggggaaaggtggagaaatgaaaacattttctatgacattaaaaat
cacttcctctcctctttccccagtgtccctaaccagaagaacctaacttaataggagatt
tcagatgacagaattgtccagtcttcctcaccaccacctcttaacccttgctcactgcag
GGCAACCTGGTTGTTGCTCTCAATACTCCACCAACTGCCCTGGATGAAACCACCATTAAC
TGTTTAATTGCCACATTCATTGATCATTTTTGCAGCCCTTCATTTTATTTGACCTCTCAG
CAGTATTTGACACGGTTGAGCACTCTCACTTTTTCTCACTTTCTTCAAACCTTCCCATCT
TCTTTCCTCTTCTTCAAGGCACATATTTCTAGAGCCTTCCATTACCCTCTGAGAGCAAAC
TCATGGTG
gtcactccttgccaggactgtgacataaatgacacctcttacattatattgcaatgattt
gtagacatgatggagaggctgggactggaccaccagtgtgactgcctgggacataaatgg
gaaacttaccccttggtggtcctcatttcactttctccatctaagcaaggaacaaagaag

Exon 17 +      91352      91391   2   Terminal     40    72        Good
tttctcttctacttgcagcatttcttccatttcaccttcctttttgagtacttttcctta
tttcatgtttttgcacttgtttctcatgaagtctgttattttctctctattctaacatcc
tcttttactggaggtaggtaattaacaaattacttcacactgaagctttaatgatttcag
GATTATTATCATTGCAAAATTCCTGGATCATGAAGAATAG
gaaatatctccaagaaacgagtctataatggtagctctcaaagaccaggaaaccctagaa
tgtctcttctcctcattggtcttcataacccatagtttgctctaaccacagccattgagt
tagaattctaagtagcccacaacttagattcattttattacttatcatttactactcata

Exon 18 +      93480      93594   0    Initial    115    83        Good
cattaaaatgtaagctctatgaaggcagggacttttgcctgttgtgctcattgtcttgtc
tctagtgctgagatcagtgctacacagagtaccatacattaaatatgcaccgaataaatg
aacacttatttatcactcaatcatgcaatgaatggatgaatgattgaaaactggtagtca
ATGCTGTCCAAGAACATGACTCTTGGGAGACTCTTGCCATGCTATTTTTTCTTCTTTGAG
ATAATCCGCAGCTCAGGCACTGAGGTCAACAACTCTAATGTTCAAGATCTTCCAA
gtaggagggaggaggttggataaacagagtttgagtaaatttgcccttggcttttgagag
agctaagtgagaatcctggctttcccacctcctagctctgtgaccactgataaactattc
aacttaggtcaagctgttcaactctggccttagctcactcaatatgtaaaatagaatgat

Exon 19 +      94222      94341   0   Terminal    120    96   Excellent
gttatttaaggatcctaaaatgaaaacaaatagcttctaaagcagttaaaataattatca
aggtatatttgttcactccagatctcatcccacaaggtttacaagagtcttggcttttga
aatctgtgtcttccaaaaattcatttgttaagcaagcactgagcacttgctctcttccag
GCACCGGGCTCTACATTACTGGCTATTCCCAATGGCAGGAAAGAGCTTCTGCTCATGAGA
AACTTACAAGATAGGCCCAAGATGGGATCTGACATCAATACTGATATTGATAATGGTTAA

tagcaggcattaggggttaagtgctgccccagaggtgcagattgttacagacatgcagag
aaggggaaagatgctttctcaaggaagcttggaagtggtcagagagtcattcatgtgagg
gaaggtcaggggaccaaaatagaggaatggaaacagcttgagcaaactcatagacgagga

Exon 20 +      97768      97877   2   Internal    110    91   Excellent
acagtttacaggcaggtcctaagagaaagaggaagtaatgtcatagctcactaagttggg
ctgaatttgaccagaagagaccccagggtctgaagttagttctgcccactgggacacaga
gatggagatttcaatgctgtgagcctgggtgtgttgtctcaaggtctccgccctctctag
GTACGTACTGGAGAAACATGCAGCAGCAGGAATTCTGAGAAAAATTAGCAGGTATCTACT
GAGGGTGGACCACAGTGAAGAAAAACCCTGGATGGGGACCCTCAGAAAGG
gtgagtgagcaacagctgcacagcaggggacacaggaccccagcctacaggcagggtttt
ctggaggcaaaggcaaaaggcagagcttcactctggtaaggagcctggagggaggcaggt
tctcagaccttgaacttggaggcaaaaagagaagcctgcgggaccctgtagcataagacg

Exon 21 +      98261      98395   0    Initial    135    61    Marginal
gcttgaaacagagcagctgtctagtcaaagctagggccatgagtcagcatcagctggtgc
aaagattcagtgtcacttgaggattgattctggggacttgggtctcactgggggagtgct
ggccaggcgggagctctggcaatgaccaagggcactaaaggctgggcctgatgagaagga
ATGAATAGGCAGGGTGGTCGTGAGGGTGATAGAAGACTCCAGCTGAATAGAGCAGGCCTC
TCCCCTGTCCTCCTCCCTACCACTGTCCCTCTGTATGTCAAAGTGCCAGCGAAGATGACC
CCACCCGTGTCACGG
gtgagactctgccaatgcacatctatctagcttgtaaaagcaactccaaattaattgctg
gccacattcacccattttctttgacttccatcctgctagactgaatgattttctttcccc
tccatgcaattttaatatcaaggatgatttttatcaagtcattctctgtaatcagaatac

Exon 22 +     106227     106358   0   Terminal    132    46    Marginal
ataaatcctcctagacttaattgattttgacttaattcaccacttctgctgaatctcctc
aaacctcatcacgtagacgtctcataattctcagaacatacctggaccattgccaacata
catccctggtgtcactttttactgtaactgttgtttcatgtggctttccccttttactag
ATTAGGAGCATTCAAGGAGAAAATAGATCTGGAAAAAATATAGATAACAATTTACGTTTC
TTCCTGAGCAACTCCTGCTCTAACAACTGTCAGAAGGAGTTGAGATATAGGAACAGGATC
ACCCCTATTTGA
cagatgagaaaattgaggcacaggcacagactattatacgttatttgtaaaaaaaaaaaa
aaaaaaaaaaagttcatataaccattttggaatgaagccacagccagaattttgggattt
tccaaccacaatacatagctgctttacactctagataagtcatgccatgttgattagccc

Exon 23 +     106762     106804   2   Terminal     43    94   Excellent
aggctgtttgaagagataaatgaccaaagttggcactgacagaatgagaatagcaaaggt
ttaaagagattggtagacaggccagagaggagcacagtgataaggaaatggagcaggtat
tagagaagttgttttcaataccatatatttttacctactatgaaaagaaagtgtcaatag
TAATAGTGATGATGATGATGATTATGATGATGATGAAGCTTAG
ggaatgcctactatgtgccaggaactgttaaaacactttatatgcattaactcttaatcc
ttattgaaagtccgtgaggcagaaactattcttagccccatttcacagatatggcagctg
gaagccacaaggtcccacttgcccaaggtgcccaagaacagcagcgctgcattttaaatc

Exon 24 +     113122     113358   0   Terminal    237    75        Good
taatgtttgattcacttttccccaacaaacacatgagcatgcgcgcgcacacccacacac
acacacacacacacacacacaggatccttgcttttgtgcataagaagtgattgttcagtg
gttgactttggagttgcaagctacttaaaatagtcctaaaaccaacacttgtttttacag
GGCCGTTGTTCGAGAGAGAACTGCAAGTATCTTCACCCTCCGACACACTTAAAAACTCAA
CTAGAAATTAATGGAAGGAACAATTTGATTCAGCAAAAAACTGCAGCAGCAATGCTTGCC
CAGCAGATGCAATTTATGTTTCCAGGAACACCACTTCATCCAGTGGTGAGTACATCTTTA
TTCAGTGATGAGTTGGATGGTTACAGTGTTGGTATGGATGATGCCACGTTGACCTAG
ggtggcctctctccactttgtcactttggttacaattaaagcaaatagctttaaagctca
atagatgaaggaaaataggcttttaaaaaaattaatagaaaaatatttgtggaaatagga
ggcaaagacaatttctaatcaatatctgggaaatctgtatcactccaactcttttcacca

Exon 25 +     118318     118402   2   Terminal     85    77        Good
gtttgtcatctttgaacctggacctgatgtcctgggagggaaagcagggcatggaagact
gcggagaggaacacgggaaggtggagtagagaacaggggcaggaaatcgcaagaccagca
tttcagaagcgattttcttcaagaaggcttcccgcgaatcttgtcctctggcctttttag
CTGTGGCTTTGAGCTGAGAGATGACGTGGACCAAATGGATCCTGTCTCAGACAGCCTGGC
AACAGCACTTCTGCAGAAACTGTAG
ggctaattctcccaagctgtagttggtgcgcttccaggaacagaatcattggaaggtgct
gcccttctcttttctcagccgccagctgagaaccaaactcagacaccgggatccgttgtt
ggccgagattctacctcgggagtttaatttgaattcaggatctgagaaccacttttccaa

Exon 26 +     125658     125913   2   Internal    256    76        Good
gtgtcagagattgtggttacctgggctccgcataatcaatcttttcttgtcagtggtaca
tgagccaccattgaaagcgaggcagcctccgctcctcccgcggtggccggggccgcaggg
gcgcctgggctcaggcttgcctctgcagcgcggctcttcttccctgtcttaggtatgcag
GGAGTTCCAGCGAGGAAACTGTGCCCGGGGAGAGACCGACTGCCGCTTTGCACACCCCGC
AGACAGCACCATGATCGACACAAGTGACAACACCGTAACCGTTTGTATGGATTACATAAA
GGGGCGTTGCATGAGGGAGAAATGCAAATATTTTCACCCTCCTGCACACTTGCAGGCCAA
AATCAAAGCTGCGCAGCACCAAGCCAACCAAGCTGCGGTGGCCGCCCAGGCAGCCGCGGC
CGCGGCCACAGTCATG
gtaagtgcggccgcccgccgcccctgcaccccggcgcctctgcggaggccgctccgggct
gggacttggatgttcttccaaacactcgggaaacatggaaggctgctattcctgctgctc
cgctgcctaagttttgctgttgttttccccctttttgttttgttttgttttcccctcctg

Exon 27 +     125833     125913   0   Internal     81    94   Excellent
tgcagggagttccagcgaggaaactgtgcccggggagagaccgactgccgctttgcacac
cccgcagacagcaccatgatcgacacaagtgacaacaccgtaaccgtttgtatggattac
ataaaggggcgttgcatgagggagaaatgcaaatattttcaccctcctgcacacttgcag
GCCAAAATCAAAGCTGCGCAGCACCAAGCCAACCAAGCTGCGGTGGCCGCCCAGGCAGCC
GCGGCCGCGGCCACAGTCATG
gtaagtgcggccgcccgccgcccctgcaccccggcgcctctgcggaggccgctccgggct
gggacttggatgttcttccaaacactcgggaaacatggaaggctgctattcctgctgctc
cgctgcctaagttttgctgttgttttccccctttttgttttgttttgttttcccctcctg

Exon 28 +     126569     126674   2   Terminal    106    75        Good
tttctcctcttctttcacttattacaagggcaatgctggtcagattccccatctcaatga
ggttttatgcagaatagcaatgcatgaaacagatgaaagtggagccatcctggctggtgc
agaaagaaaaaaagacctgtgacctaggcttgcttccctgagtcaccctactgtcattag
AGACCAGCAGTACATCATCATTATCATCGCCTGGGAGCCTGCTCAGAATCTCGGAGAGCC
TAACTGTCCCTTAGAGACCAGATGCACCATTATTAGGATCACCTAG
aagcctgtggagcctccagaatcctcagcctcaccccagacctcagggaatcagaattta
agttgtaaaacatctcccaggtgttttgtatgcacattaacatttgagaagcacctgcct
agacattgcttatcaaacttggctacattttggaacaacctgaagggtctgacctgacat

Exon 29 +     136328     136481   0   Internal    154    97   Excellent
tcgctctcaataacaaattctcactcattcgacattgccgctgtttaaattaaggtgcat
ggcagaggcatctccttagctgtcatttttaaaaagaatgttgcaattgatgatctctgt
gaacatggaaggtgtgtttgctttaagttagacatatcttatcgaattcttcatttctag
GCCTTTCCCCCTGGTGCTCTTCATCCTTTACCAAAGAGACAAGCACTTGAAAAAAGCAAT
GGTACCAGCGCGGTCTTTAACCCCAGCGTCTTGCACTACCAGCAGGCTCTCACCAGCGCA
CAGTTGCAGCAACACGCCGCGTTCATTCCAACAG
gtatgtgcccttactgccctacgtcctgtgcccttctggtcatgtgctttcttctcattt
ctctaagctgtttggtggcatctagtttgcttttgaaggtataatacagtttgaaattca
tcgttgtcctagctatctaaatgtatttaccttactttgaatgatagctaaagactgtta

Exon 30 +     138438     138570   0    Initial    133    46    Marginal
tctgaagccctccagcacatgtttaactctcaaacccaacaatgactgatttgttaaatc
actgaaagaatcatcactttaaaatgtttcaccttttaaacattttaaagcaaggataaa
catttccaaagcaaggataaacaacatcccttacgcaacgacctgatttttgttgatgaa
ATGTATCTCATGAAGGACCCATACGGCTACATTGGCTGCTGTGGTTGTGTACTTCCGCCC
TCTGGTGGATTCTTTAAGAACAGCTTAAGTGTGTCTGGCAACCCTCAATACAGTGGGCTT
TGGAAGCCAAAAA
gtgggtcctagcgcaccaatacagtgactagaagggtttccatttcttacatgacatgaa
tatcagagtgaacaagcatgtggatctagtgttctgaaatggtatttcaactgctaagaa
ttttcacatttctcttaaatgaggaaagagaaaataattttattaaaaggaaattaaaat

Exon 31 +     139973     140058   0    Initial     86    54    Marginal
gacttggtgaaagattgatcagtgtttagtggcatctgtatctgcataagcacaacaaaa
tttattccattcaattcattaaaacataccttgaacccgtggtatgttctgggttccaga
gccagtaatgagaatacaaaagagttcataaagaggtgaaaaccaaatattatacagagg
ATGAAGGAGTACCTGAGGGTCTGGGCAAAGCTATTCGAGAGTGAAGGAGAGGAGACAATG
AATTCTGCCTTCAGCATGTGCACCAG
gtggtggttacgaaggatatggagaaacaagactttctgaagtaggagaaatttgcctag
gagtttgaagagaagcaagattttatcagtgggggaaaagcatcccagttgggacatggg
aagagtgtacttgaagaatagaaaattgtccattgtagctataacatgaagtacatacag

Exon 32 +     146059     146188   0    Initial    130    78        Good
cctcagtcttaggttctgccaaactcacttggttcccaccttacaatctgctccaatact
ggcctaagagccaaaccatccggaatgaagagtcatgggtgccgctgaactcacaaaggc
tggatataactgatgaggagcatttaactctgttggtttaatgcatgtgccagtgagacc
ATGGATGTACTATTTCGTAGTGACAGCCAGCTGCTATTTCCTACTCTGTGGTCACAAGCT
GATTGTATCCGTGACCCTAGCCTCCCAACTTGCAAACATGTGCTCCTAGCCACAAGGAGA
CAGCGTGAGG
gtgagtgagcagaaactctcacctcgcctggaagaatacttcattgcgcatgccctccct
tcacagaagaacaattttggtttggtttttagtttcatgggtttttaaaaataaaatcag
ctctgctaataaaagatgacaagggataaaagaaattaggggaaatcgtgttgggggatc

Exon 33 +     150267     150349   0    Initial     83    49    Marginal
tcatttaatttacttaatcacattcttaaaggcacaattaaaatacaatttatactccga
atctttccctgaacatctctctcctcctcccccagcaagaagtactttccctgtcctctg
aattctacaaggactttgcacattccttaaggcaccatcattaaatagaaagaaagacaa
ATGCAAGTCTACAAAGAAAGCTGGGGAAGTATCAAGTTCAGCTGGAGAATAACTCCCATT
CAGATTGATCAGAGCATCCGTTT
gtgggagcggctgcagcgtaggtttgattctgattgattgtgtggtaccttgatgccaag
ttaaagggttcggccctgacttggccactgaaggattttcaagcagaatagtgatggaaa
cagtactctaggaagagtgagcagatggattcgaggcgggagagtctgtagaggccatta

Exon 34 +     154606     154740   0   Internal    135    98   Excellent
catctgctttccacacgccattatgttaaacccaccgggactctgtttccctgttttaca
tgtgaagacgtcacatgtttggtcacagctccagtaggtagcagagcctgcctttggcct
cacatctgtctgactttgaagtcaatgcttttccccttgtttaacattcttcctcgatag
CATGTGTGGTTTAGAAAGGAACTTCAGAATCCATCTCAGACTTTATATCTCATGATAGAA
GAAGAGAGAACAGCTGTGATTGTGTCAGATCTAAAGAAGAGGGGACACTGTGGCTTATGT
GAGCCAGCGAGTGGG
gtgagtgggagacaccagggagcgtgaagaggaggatatggtggggcagtcctagaaatt
gcagctgagtggatcagaaggtcgggttatggagggccttaaagtgcaggatgagaacag
gacaggacaggttccatgagaggcttggaaactcaaaccaactgaaagtgaatgggtaga

Exon 35 +     158457     158533   0    Initial     77    69    Marginal
tttcttcaccatccccacagaacctcactttcaaattgatctcaggtaaacgtaacaaca
ctagttgaggatgaatattttaggcagcctgcaggagcgactgtaaagggaacaactaga
agtttaattcagttgtaagtgaaaccacagagctaaatgaggaagcaaacggggatctta
ATGATGATTCAGATGTACAAGCAGAAAGAGCCAGGGGTCTCACTGCGAAGCCCCAAATGG
GAAGGAGAACAGAAAGG
gtgggagggtgggaaagaaggaatggaaggagaaagggattcaggattggcaggaaaggg
ggatgtggagttattctctaacgggggcaggtttcatttggaatgaggagacattctgga
gatggagggtggtgatggtggcacaaccaggtgaatggagttaatgccactgaactgtac

Exon 36 +     163240     163355   0    Initial    116    68    Marginal
ttatagtcatgaaataggccaaagaaagttcttgaaagtgtacatttgttaacatgtata
attataattgctttaattacttttttatctgataccatatattcactaagagactaagac
acttcttttgacttcagtaatccatactgtgattaagtactgaattatactggagtcaaa
ATGTACACATGTCCCTTTGCCTCTGTGCAGTTTGCTTCAACTGAAAGATCTCACAAGTGT
AGCCTCTCAGGCAAGATCAGGGCATTTCAGACAGTCATGGCTGCTGTGGAGAAGAG
gtgtggggcagtggggaaaaggtggagagaatattaaatggtgcacagactaaaggagga
agcaatgctaacagagagtgggaagaaggaacttgtgagacagaatcagaagaaaacact
ggatgaagaaacacagactgggagggtgagcaacgtgcgagcctccttagcttagcccta

Exon 37 +     163393     163500   0    Initial    108    84        Good
taagtactgaattatactggagtcaaaatgtacacatgtccctttgcctctgtgcagttt
gcttcaactgaaagatctcacaagtgtagcctctcaggcaagatcagggcatttcagaca
gtcatggctgctgtggagaagaggtgtggggcagtggggaaaaggtggagagaatattaa
ATGGTGCACAGACTAAAGGAGGAAGCAATGCTAACAGAGAGTGGGAAGAAGGAACTTGTG
AGACAGAATCAGAAGAAAACACTGGATGAAGAAACACAGACTGGGAGG
gtgagcaacgtgcgagcctccttagcttagccctatttttaggaaatgccaattaattgc
ctatttttaaattaataataaattttgtttaaagaggcagtgaaatattattaatatctt
taactgccttctggggaaacagggccttgtaaccatggcaaaagatttctaagaaaccta

Exon 38 +     165053     165169   0     Single    117    52    Marginal
atgtttcataactgatgactcagtcaagggagggttggtattttctttttaggtagaggg
tgccttgttggtcacatactctctttctttgggcgaaagccaaatgtctgaaagttgtag
gactaactctcctgtaaacctgctctcctggtctcactcttaccactgctgcctgccatg
ATGTTGCCTGTAGCGTTGGCTGATGCCAGCTCAGGAAGCCATCCAGACTTAGTGAATATA
GTGGATATTGCCTTCAAGAAAGTAAAGCTGATGAGGACACAAACCAGCAGCTCTTAG
ctgaatttagcccaaagatatatatgatccttctgtgatgtgaattcattgctgaatttc
cagcttcttttggcaaatgaaaaggtcaagtaatatggagcccatgtttccgcaggtagc
acttggctggggctgagtggctgttgccacaccctcgacctggcctattcacttacatat

Exon 39 +     166421     166540   0    Initial    120    46    Marginal
gaggcccagcagcctcacagtcccccagcaatttccacccatctagcccctccaaacagt
ctcactgtctcccctctaaagctccaagtgcatttgctgtaggttccaccccagggcctc
gccttcccctgattcccaagctcacaggggttcttctaagcaccctctgaagcaggctcc
ATGAGGCACAGCCATGCTCTTTGGAACCTCTGTGTCCCGTCGCCCTATCTCAGACCGTCC
CCATGCCCTGGAGGGGATGCCTTCACCAATGAGCAGAGTGACATCTCCAAACTCATGCTG

gtttgtgcaagcactttgtacattgtgcaagccagttaaaattatgcacgtcatcttttc
catgtctgcaaaatatgatcacaatactgacctagcttgtaagactctagcttgtaaatt
ctcagagcctcctgaaaatcaaggggatatatcttaaaattcaaacaaaaacaagggtgc

--------------------------------------------------------------------------------