--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (22154 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (4 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1009       1485   2   Internal    477    53    Marginal
gactgctttccttaatagagaaatctctctgagccaaaatcggcctcccccaattccatc
ctgtcggccccacttttctgcttcggagacttccaagccagtccccactcctccttcagc
cagtcgggcccgcacccgcgcccggcagggccagccctctcctcctcctgcgtggcgcag
CACAGGCCCTGAGCGCGCGACCCCAGGCCCTGGGCGCCCCGCCGCATGCTCGCGGCTGGA
AGCCCCAGTTTGCGTGGCCCTTCGGGTTATTCCGCTCAAGAGCCGCCGCGTCGCCCCATC
TCGGCGCGAATCTGAAAGCGCTTTCGGGGGAGAAGATGTTGGGGGCACTGGTGAGTACAC
TGCACAAGTGACAAAATGTTTTCAGCTCCTGGAGGCGAAAGGTGCAGAGTCGCTCTGTGT
CCGTGAGGCCGGGCGGCGACCTCGCTCAGTCGGCTTCTCGGTCCGAGTCCCCGGGTACGA
GGAAAGACCACAGGGGGCTTCTCGCGGAAAAGCGGGCCGCGGACCCTGCGCGGGCTGGCT
GGGGCGGGCGGATGACGAGGCGCAGGGGCAAGGGTGGGTCTGCGAGGCGGCGGGTCCGGG
CGTCTTAGGCTCCGGGGCTCCCTCGCTGGCGGCGGAGCAGGGATGGCGCGCCCGGGG
gtgagggtgcggcgggtcacaagcactcgcagcccgcggcgcagcaacccggcaggcaca
cgcacacgtgcacgcgcgccccgcacccgccccccgtgcggcccccggctcggggcggcg
gcggcggcgggggccgggggcgcgcgggccggcgccgggctgggccccggggaccccgcg

Exon  2 +       1860       2153   0     Single    294    60    Marginal
ggggagggcgctctggggcccgcccgcgcggctcccatcctccgggccggcctctggctc
cgcggggcgaggggaggcgcccgccggctccgggcgccgcgggcgggacacgggcgcggg
gcgcaggcgggctcctccggcgcgtgcggacgctgagcgtggcctgtccctcaggtctgg
ATGCTGGTAGCCGGCTTCCTGCTGGCGCTGCCGCCGAGCTGGGCCGCGGGCGCCCCGAGG
GCGGGCAGGCGCCCCGCGCGGCCGCGGGGCTGCGCGGACCGGCCGGAGGAGCTACTGGAG
CAGCTGTACGGGCGCCTGGCGGCCGGCGTGCTCAGTGCCTTCCACCACACGCTGCAGCTG
GGGCCGCGTGAGCAGGCGCGCAACGCGAGCTGCCCGGCAGGGGGCAGGCCCGCCGACCGC
CGCTTCCGGCCGCCCACCAACCTGCGCAGCGTGTCGCCCTGGGCCTACAGGTGA
gccgcgggcgcgtcctggcggggcccggcaggtggggagggcagggctgggcggggagag
tgggtggggccgggccgaggccgggcaggcggggagggtggggcggggaaggggaggtgg
ttggggcggggcgacgcggagggggcgtggcacgcggggcgaggcggagcaggtaggggt

Exon  3 +      17690      17757   0    Initial     68    86        Good
gtcagcatcatcactcagcaaaatgctgagatcggaaaatgaacagacacgacactatta
tctgccccgcaggccttctttagggggtccacaaatgcccctttctgccctaggatccaa
cctccagcagccactcgttttgtggaatgtccccgagtttgggttgcatgtgtttgataa
ATGATTGTGCAGGTGGTGATACTGGGAGTGGAAGTGGCTGGCTTCATGTCACTGCGCCAG
GACGGCAG
gtgtgggcccagccaggacacccccggcttgtgttcctctactcaaggcgctcgtgtagg
ttccctccctcttgtttttctcctggaacaacacgggatatatcaagtttcctacattcc
gtcctttgttggtcacgtcctcatagtgtcatttctctctatttctggtagcctggctcc

Exon  4 +      19494      19812   2   Terminal    319    83        Good
tttcaaatgtaaggaagcgccgggcagatctgttgtcggcggggggcctcgcacgcacgc
gcccgcaggcggaggacaggacagtccccgaggccctccccggtgactctaaccagggat
ttcagcgcgcggcgcggggctgcccccaggcgtgacctcacccgtgctctctccctgcag
AATCTCCTACGACCCGGCGAGGTACCCCAGGTACCTGCCTGAAGCCTACTGCCTGTGCCG
GGGCTGCCTGACCGGGCTGTTCGGCGAGGAGGACGTGCGCTTCCGCAGCGCCCCTGTCTA
CATGCCCACCGTCGTCCTGCGCCGCACCCCCGCCTGCGCCGGCGGCCGTTCCGTCTACAC
CGAGGCCTACGTCACCATCCCCGTGGGCTGCACCTGCGTCCCCGAGCCGGAGAAGGACGC
AGACAGCATCAACTCCAGCATCGACAAACAGGGCGCCAAGCTCCTGCTGGGCCCCAACGA
CGCGCCCGCTGGCCCCTGA
ggccggtcctgccccgggaggtctccccggcccgcatcccgaggcgcccaagctggagcc
gcctggagggctcggtcggcgacctctgaagagagtgcaccgagcaaaccaagtgccgga
gcaccagcgccgcctttccatggagactcgtaagcagcttcatctgacacgggcatccct

--------------------------------------------------------------------------------