--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (32712 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (8 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1378       1654   0    Initial    277    42    Marginal
cagtgaaacagcagattacttttatttatgcatttaatggattgaagaaaagaacctttt
ttttctctctctctctgcaactgcagtaagggaggggagttggatatacctcgcctaata
tctcctgggttgacaccatcattattgtttattcttgtgctccaaaagccgagtcctctg
ATGGCTCCCTTAGGTGAAGTTGGGAACTATTTCGGTGTGCAGGATGCGGTACCGTTTGGG
AATGTGCCCGTGTTGCCGGTGGACAGCCCGGTTTTGTTAAGTGACCACCTGGGTCAGTCC
GAAGCAGGGGGGCTCCCCAGGGGACCCGCAGTCACGGACTTGGATCATTTAAAGGGGATT
CTCAGGCGGAGGCAGCTATACTGCAGGACTGGATTTCACTTAGAAATCTTCCCCAATGGT
ACTATCCAGGGAACCAGGAAAGACCACAGCCGATTTG
gtaggtataccattaaccctttagtgtccatgagatgacatgttgaaattataactacca
agaaggtggtggccgggtgggggacgtgggaagggttctcccctcctcccctctttctct
gtatctctgtctctctctctctctgtcttgccagctccgaaaaaaaaatgcctccggaat

Exon  2 +       2757       2822   1   Internal     66    73        Good
cacagtcccaattgggtggactcttgagttttttccttacttaaaaaaaaaaaaataagc
gccagtttgggcaactagactgttggaaggagttaacttctgagtgaacccacctgacaa
cacttaaactaggtcgtaaaaaacaaagtcctctggtgatttttcttcctcatgctttag
TGCCAGATGTTGAACACAATCTAAACTGTATGTTTAGCTTCGTGCGGCTGCGGATGATGC
CAGAAG
gtgaggaggacttaggcctgggctggggatggtcccagatccacgaggcccaggatttgc
tcctcatgctcacccctgagcctaagcccacagctgagcctagtagtgtgaaattgctcc
ggccgtctccactcgctgcttaaaaaaaagttatagctctttgctttgcaattattcagt

Exon  3 +       8847       8895   1   Internal     49    73        Good
atcctattaaaataattacattaagcacaagataaatttgttacattttgtccttataaa
agaattaggaatgcccctttagaagaaatagctcttcttttttacatcaccttgaaatag
tttcctcttgagttaatcctttattagatttatgctgttcatgtcttcttttgattgcag
TACCAGTGTATTTTGTGAGAGTTGCAGAATTAATTGTTGAAAAATTCAT
gtaagtgcttttttattagtcacatgagactgactatagcacattgttaccctaagtttt
tttctgaactcttaaatgtaagtaaaatttttaatatttgaaagtatttttaaaacaaga
actcaatatttgatatgcattaatgtaaggtctacataaaatgtagcactttaatttaca

Exon  4 +      10507      10665   1   Internal    159    98   Excellent
gttgaaaatcaattcttttacacagtgattttcaaagagaagacacttctttaactagcg
tggggttatccaagtggggagctgggcttagtgtcctctccaaaaccccagggatgctgg
gactctaaggacatgctctgtgatctgatctgtcctctgccttctaccctttgtctacag
GCATTCTGGAATTTATCAGTATAGCAGTGGGCCTGGTCAGCATTCGAGGCGTGGACAGTG
GACTCTACCTCGGGATGAATGAGAAGGGGGAGCTGTATGGATCAGTAAGTACTGGAGGGA
CTTCATCCAGCTTTATCTCCATGTTTGATTTGAACAGCT
gtcttttctctggattaaaaagggccagaaatgcaactgagtctgtttggaaggcgagtg
taagtttttactttttgaggaaagccattttatttttattaatagataaacagctctgca
ccttcactagaccaaagttgctaagaaaatgctttatttatatgccaaaccatcttaatt

Exon  5 +      11154      11206   1   Internal     53    55    Marginal
atagaccatgcagtgaatctaaactctctctgagctacatccaagattttcattatgcag
agaagaagggagatggaaattgttgtcagatatttttgtacgtgaataagaatattacga
tattgtaattatttgcaaatgttatgaatttctttttttcccactccacatccccactag
GTTGTAAGGTCCTCATGGGAGACAGTGAAGAAGTATTTATTGTGCTCTGCCAG
gtgccagacaggcactgttataggtgctgaggtgtgaatgagacaaagtctactcttcca
ctctgtggcggggactaactttccatcatggtatcactttactcctattaatgcagtacc
taaaacacagtgtgtggtacgcagcagggacttaatacatttttgctgaatgtataagta

Exon  6 +      17917      17979   0    Initial     63    97   Excellent
atgcagttcacacaaaggagatgaataggttcatttccttagtaacctacctgataacag
gcatgccctggagatgggtggttttcaacggatattttgagtaattgagcattgccttat
gctgtgtttcatatgtgcgtgaccaattttcaaagaattgaataataattcttagacgat
ATGGAGGGCAGCTTCTGCTGTATGACTGAGTCCATACATCGTCCTGGTTTTAGAGACGAG
GAG
gtgagattttagtggcttagtgacttgttgaaggtcacatagatgatgacaagtcaggat
ttgaatgtaggtaaattagtaaatcttgtctgatacatatgcatgttaagagtggccatc
catttttgtaaataaaaatatatttactagaattaatcacatgaatatttttaactggaa

Exon  7 +      22078      22267   2   Terminal    190    57    Marginal
cttgcatgctgaccagttgcaacttggagatgaagcacggttagtggaagcacaggcccc
gggatcgccactttgtcactcactggccctgcagccatgggccgtcttctcactctttct
gagctgaggctatagaacgggctaacgatagacacttcatagctgggctgtgaggattag
AGAAGATGACGCCTACAAAGTGGCCCATGTAGTGCTTGACTTTTGTGTCTGCTCAGCACA
TGGTCACGCTCCCAAGTGTGTGGGGGTGACAGAAATGCTGTACTCACACGAGAGACGCAC
TGACACTGTGTTTCTTGCGAGTTTGAATTCTGAAATTAAGACCCATGACACAGCCTCCGA
AGATAAATAA
aaaatttcctccagatcccaacatgacattcctcaaattatatattaaaatgccaacaat
aaagccttatttaccaagattaattttacatactttattctcatgtgctgctcatgatta
ttttatctgctcaattaaacaaatttcttttatgaggggtttaatttactttgtgattat

Exon  8 +      30655      30900   0   Terminal    246    72        Good
tttaaaaaattttaattttaatttttagttctggggtacatgtgtaggatgcgcaggttt
gttaaatagataaacgtgtgccaaggtggtttgctgcacctatcaatccatcccctaggt
attaagcccagcatgcattagctatttttcctaatgctctccctctttttctttttacag
GAAAAACTAACCCAAGAGTGTGTATTCAGAGAACAGTTCGAAGAAAACTGGTATAATACG
TACTCATCAAACCTATATAAGCACGTGGACACTGGAAGGCGATACTATGTTGCATTAAAT
AAAGATGGGACCCCGAGAGAAGGGACTAGGACTAAACGGCACCAGAAATTCACACATTTT
TTACCTAGACCAGTGGACCCCGACAAAGTACCTGAACTGTATAAGGATATTCTAAGCCAA
AGTTGA
caaagacagtttcttcacttgagcccttaaaaaagtaaccactataaaggtttcacgcgg
tgggttcttattgattcgctgtgtcatcacatcagctccactgttgccaaactttgtcgc
atgcataatgtatgatggaggcttggatgggaatatgctgattttgttctgcacttaaag

--------------------------------------------------------------------------------