Gene TFCP2 Variant 1
DNA : 78.04 KbNT_029419
mRNA : 2370 bp NM_005653
CDS : 1509 bp NP_005644
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  581 bp
cgagtctaggttttacgcctgtgctggactttctccttccatgtttccaggccgtggggg
gctacagagggcgagaagtcggctcagcggaaacctggatttggttctaagccgtggggt
tgagaaggggtgaccggaagtgatcgtgggactgaccggaagcgaggcctggaggggaaa
GAGAGAGCGAGACCTGGGAGGGAGGGGGCCTCCAGCAGAAAGGGGCGGGGGAAAAGGTGC
AAAAGCAGCGTGGGAGCGCCGGGCTGGCTTCCTGCGGCTGCTGCTGGTCTGACTGGGAAG
CAGCAAGCCACCACTACGAACTCTCAAGAGGAGTGGGAGTGCGGGAGTCCAGAGCTGCCT
CTGGGAAGTCTGCAGTAGTTGAGCAAAGGGGTCCTCACGTTCCTGAGAGCTGGGCAGGGG
GGATTTTGGAACCTGGGGCAGCCAAGAACGAGCAGCCAAGGGTACGGGAGATTAGTTGTG
CACAGAGCAGTGCTGGTCGGGCTTGGGGGTGGCTGGTGGGCACTGCGTGGGAAACCTTGG
TTTGTAGTTTTCTTGGTTTGCGTTACTCCTGTTGGGTAGAATTACCCTCCGCGCCTTTGT
ACAAGACACGGTGTCTCCTGGGGCAAGGAAGGAGCCAGGATGGCCTGGGCTCTGAAGCTG
CCTCTGGCCGACGAAGTGATTGAATCCGGGTTGGTGCAGGACTTTGATGCTAGCCTGTCC
GGGATCGGCCAGGAACTGGGTGCTGGTGCCTATAGCATGAG
gtgagtgagattttcccagaccctacaccttctgaataacaaaggcggatagacactaag
aaaaggggttgagtgggaaggaggtgtatagagttttaaaaagctgtttacgattgggga
aaagggacttgttcttttgtcgctttgagtagttagtgttgtggaagaaatggaaaaagc
EXON 2  152 bp
cacactgttgtggtcagggggatatcacagcaggtaatctaaatggaattcttgggatga
aactccaccaaggtgagtaatgtttatggctttccaaagcattgcagttaaatcattcag
caataaacctgcgtttgcaccattgccaggtattaatgtgagtcatttgttttattttag
TGATGTCCTTGCATTGCCCATTTTTAAGCAAGAAGAGTCGAGTTTGCCTCCTGATAATGA
GAATAAAATCCTGCCTTTTCAATATGTGCTTTGTGCTGCTACCTCTCCAGCAGTGAAACT
CCATGATGAAACCCTAACGTATCTCAATCAAG
gttagatgcttcctcattcattagtactattgcagacctactgtatttatgatttttttg
tttgtttgtttgttttgagacggcgtcacccaggctggagtgtagtggcgccatcttggc
tcactgcaagctctgcctcccgggttcacaccattctcctgcctcagcctcctgagtagc
EXON 3  77 bp
tgagataatgtgacaatacttagcacagtgctgagcatcttgtaaaggcttctgattgtt
gttactaatactaataatattattatactgttgtatattcaaccaactgaattttattct
ttccgaatctagcaaagttaatttgtggtgaatataatatgtaattactttttcttctag
GACAGTCTTATGAAATTCGAATGCTAGACAATAGGAAACTTGGAGAACTTCCAGAAATTA
ATGGCAAATTGGTGAAG
gtaaaacgaataaatcattcttctgtacaatattttttactaatccttttgggattttaa
attttgttgttgttgttaatgttcttttgcttccaatggcttaatggtatctcttgcctg
cagtaatttgttggcagagtagtaagctgatgtgttatttctttggggtcagagtaagcc
EXON 4  106 bp
aaaattttatcctgaaatagcacttagtatggtatgggttttagagtgaaacagatctta
agaaaaataattttagattgcgtttagaaacaaactggcagtgaatcctgctagtttttc
tttgtcagcactgattttcaagaggtcttgttatcatctgattttgttgtatccttttag
AGTATATTCCGTGTGGTGTTCCATGACAGAAGGCTTCAGTACACTGAGCATCAGCAGCTA
GAGGGCTGGAGGTGGAACCGACCTGGAGACAGAATTCTTGACATAG
gtgagttaagagaatctattgcctaggaaatgcctttagctatggacccagagttggttt
tctttatttgacatttaccttgattcatatgcttgagaggctcaattagtataaaccttg
aaattatttactaagcataaaaaattttaagtaatacaagttaaaatgatatcaaaattg
EXON 5  107 bp
ggcaacagaacaagactccataaaaaacaacaacaacgacaaaaaaaaaaaacaaagaaa
tttaggatgtgatatacaaaaatcttggtagctacattgagtaatataagaatcaatgct
ttcttatttaaaactgagtggccctcaaaattgttcaatgattaccattttgtttctcag
ATATCCCGATGTCTGTGGGTATAATCGATCCTAGGGCTAATCCAACTCAACTAAATACAG
TGGAGTTCCTGTGGGACCCTGCAAAGAGGACATCTGTGTTTATTCAG
gtaaggcgttgcagatagggttccagttttgaagagtatctctcttactatcagtttatt
tcttaaaggataaaacatgttaactttgaaatctttacagggttctagcctgactgtcaa
gcccaggctctttaacctgtgcctgagagcattgaggagtttctgaattgctcttctaat
EXON 6  153 bp
gcatttttctatttcctctatcagattgtaagttcttcaagatcaaaaagaggaaaagtg
ttttttgtaggtattcataatgcctggtaaaggttttgctgttaatagttgctaaaaaaa
tactgccaactggtttggctagctagcggtactgaagccttgctgttgtattcttttcag
GTGCACTGTATTAGCACAGAGTTCACTATGAGGAAACATGGTGGAGAAAAGGGGGTGCCA
TTCCGAGTACAAATAGATACCTTCAAGGAGAATGAAAACGGGGAATATACTGAGCACTTA
CACTCGGCCAGCTGCCAGATCAAAGTTTTCAAG
gtattcctgggcaatgtgctggcccttggattcttttaccttatcattctattttaacat
tagttaccaagtcagaaaatcaacttgtctttttttgaaaactcacacacacgcaaaaag
tctaagctagagtcattgaaataattaccaagatgcctggtaaagaaatttacatggtcg
EXON 7  111 bp
tcaactccatcgaatataaacatttaaatttcctattttcaaacttaaagtgatgtgtct
tgcctttacatcactgcacatacaattttgtttcatacatgaatatttaagtttttggaa
gcaatattttgggttaaaaggtgagtacctgaatttaaaacaaaatatttctcatttcag
CCCAAAGGTGCAGACAGAAAGCAAAAAACGGATAGGGAAAAAATGGAGAAACGAACACCT
CATGAAAAGGAGAAATATCAGCCTTCCTATGAGACAACCATACTCACAGAG
gtaaaaagatttcttttggtgacaatttcagttcataatttttaatcttaaaaattcatc
acttccaaactggtcagaatttacttctcctaagccttgagggacacagtatcacatgga
ttctgtgtccagcggccttaacaggaagattgctttagaatttggcacgaaccatgccac
EXON 8  89 bp
agcaggcctccccacaggctccaagatggcggaaagagaagcagtgttctctattgctta
tgggagtctctgaggaattaagatttactaatcaagatgtgctattcaagtaacaatgtt
ttagtcaaatcctggggtcatatgtgctcgttcattatctaacttatcctttgtttttag
TGTTCTCCATGGCCCGAGATCACGTATGTCAATAACTCCCCATCACCTGGCTTCAACAGT
TCCCATAGCAGTTTTTCTCTTGGGGAAGG
gtaagtctgggaaataaaattggcttatatttgtccaaaatatatattctttcattacct
gttcataaacaagatcttttttaaatcaataagtatatctatttggtcgttctttgatgg
atttatatattaactgagatttggagtagcttcaaaagagatcgaaagagttttatatag
EXON 9  49 bp
agtctttaggttaaactaatagaaaattaaagtattgggtcaaagaataagaatgtgtta
tgagagagcacagatttttttttaatctctagcatgagatttattgtgaagctgaggaat
gaaataatgagccccagcatgtgtcatggactcatcctttcattttaaatgtttctttag
AAATGGTTCACCAAACCACCAGCCAGAGCCACCCCCTCCAGTCACAGAT
gtaagtctaaagttgaatgtcagttacttgcaatgtctggtaatactttgatgactgtcc
aattcagtagaaatgcccaacttttagggagtattattcattcattcattaaacaaacat
ttattgaattttgactatgaaccagatactgtgctagggactaaagatatgaaacaagta
EXON 10  94 bp
gtctagtggggaagaaaaggatggaactccttgagcatcttgcatggttggagaaagaga
aaacaactttcacaaactaggcctgagtatggggttgtgtggggtgtttggctatgtgtt
acctaatggggtaacagacaaatctatttggttatctaaaaaacgtgctctccctttcag
AACCTCTTACCAACAACCACACCTCAGGAAGCTCAGCAGTGGTTGCATCGAAATCGTTTT
TCTACATTCACAAGGCTTTTCACAAACTTCTCAG
gttaaattttctttttcttttgttttccctagcatgaaattttcctttgcattctagggc
ctcctggtatccatgggagagttgtgtgtgtatatgtgtatgagagatcttactgcattt
ttctgatgaaatgaatttcatagaacccttaagactttctcactagctgcagctgtgctg
EXON 11  91 bp
gggggaattgagacgggagaggagctaggagccaggtcatgaagggccttatatgccatg
aagaaaattatggattgtaacattctggtaatgaggtgtccttataatacagcccatttt
aatagtcattaacaaagagaatctttgcctttatcatccattttcttatatttattccag
GGGCAGATTTATTGAAATTAACTAGAGATGATGTGATCCAAATCTGTGGCCCTGCAGATG
GAATCAGACTTTTTAATGCATTAAAAGGCCG
gtatgtaattagtgttaaaatatcaataaggttgggattccaaatggatttggattcagg
aattcttcacaatactctacacagctaaatacaccttctcaaaacatttgttttaaatgt
cagctatgtaccaaataaagattttagaaaaatgttttcttgcactttgtccaaggaatt
EXON 12  125 bp
gaaaaaaaaaaccctactactggggaactaataaaacatagcaaattaattgcatttggc
caatgagcttccaattttcatctgctctatacgattaatgtagaaacacaatttctccct
tctttttattgtgcttaccataaagaatgtaagactaattagcctttttcctccccttag
GATGGTGCGTCCAAGGTTAACCATTTATGTTTGTCAGGAATCACTGCAGTTGAGGGAGCA
GCAACAACAGCAGCAGCAACAGCAGCAGAAGCATGAGGATGGAGACTCAAATGGTACTTT
CTTCG
gtaggttgttctggacacactaggacagatatgaagaaaggtgaagagataacttatggg
catgtgtgatgggaaactatcaaacagcagatttagtatttgctagaagtaacaataatc
actagcatttattaagttcctaatacatggcaggtgccattctttttttttttttttgag
EXON 13  143 bp
ggcctaggaatgttaaataacttgccctaggtcacacagctgcaagtggttgagccagga
tttgaacttaggcagtgtgatttctgagtccttcagaaaagtgggcattcctagtgatca
agttacctgtaagagtggacaaactttgtactgactgctgttgctctctcccttttgcag
TTTACCATGCTATCTATCTAGAAGAACTAACAGCTGTTGAATTGACAGAAAAAATTGCTC
AGCTTTTCAGCATTTCCCCTTGCCAGATCAGCCAGATTTACAAGCAGGGGCCAACAGGAA
TTCATGTGCTCATCAGTGATGAG
gtagatttttcagtacagttgaattaccagatgatgattaatttgtcagcgcatggagca
agagcagttctcctggggcagagtgttctgttttctagatcagagggtttcatacttttt
tgcttgctttcctcctaattttttttttttttgaaacagtctctctctgttgcccaggcc
EXON 14  52 bp
aaccaaatgggaggggaggaaaaaacttttatgatcctagatattcaagaaatacattat
ttgtgacctgtaaagcctcccatataaatccctctggatgtggggtagtccttagggaca
caggaatataaaggggttgtttttcatttaaataatcacaaattttcttgcatttttcag
ATGATACAGAACTTTCAGGAAGAAGCATGTTTTATTCTGGACACAATGAAAG
gtaatagtaagacaaacatctttctctaagcagtttaacagctttactactactaggcaa
agtacatacttctttgaggagagataggaaaagtaaccatatttgggtaaagaaagtgac
aatattagagattgttcctttttttaagttggcttttttttttttttttttttttgaaac
EXON 15  440 bp
tttttgagacagaatttcgctcttgttgcccaagctggagtccagtggcgtgatctcagc
tcactgcaacctccacctcccttttctccccttctcacgagaatcttaccatactttttt
tctcctgctgtgttttagaggtgactaaagatgattctctctctctcttttttttaacag
CAGAAACCAATGATAGCTATCATATCATACTGAAGTAGGAGTGCGGCGTTTCGTGCCCAG
TGGCTGCTCCTTCCTTCACCTCTGAAAACGGCCCTCTTGAAGGGGGATATGAATGGAGAT
TTGAAGGTCTGCAAGAACCTGACTCGTCTGACTGTGTGTGGAGGAGTCCAGGCCATGGAG
GCAGAATCCTGGCCCTCTGTGTTGGCCCAAGCTCTTGTGGTACACACAGATTACTGCCCA
ATATGCAGTTCTGCAGCTGTTTTAGTTAAATTTCTGGACCTTGTTGTTGTTAAATATCAG
TAGAAACTCTACATAATTTAGAGTGTATGTAGGGCATAATGATGATGGGAATTGTGTGAT
GTTTAACAGGAAGATCTTAAATTTTGTGATATGGAGCCCTGTAATTTTTTTCTTATATAA
AAATGGGTATCTATATTCAT
aagactaggtcttcaatctctttgtactggtctcaaatgtactggtatctctgctttttg
ccacagtttgtccctgaaaactttatcagtgaggagaaatacagaattttccttttggtt
cccctgtaataccacaactaatagtattttcagctaacatttattgaccaggcagtgtga