Gene STAT2 Variant 1
DNA : 17.40 KbNT_029419
mRNA : 3290 bp NM_005419
CDS : 2556 bp NP_005410
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  50 bp
agtgagctcgcagtctgggaagggcttgactgaatggcagccagtgtcggggtggcggct
gggaatgggggccgctccggacttccgctgccaactacaagggggcgggtccgagggggg
ttagccgaagttgtaggcggggcgcgaggttctagtacccgagctcatactagggacggg
AAGTCGCGACCAGAGCCATTGGAGGGCGCGGGGACTGCAACCCTAATCAG
gtacgggccctgagagggtgtgctggggtaggggtgggggtgagagtgagagttcctccg
agggaagggcgactggccccaggggttaccccctggagagggtagcttcggtccccagat
tgaaataggagctgtcgcctgctcggtcctcgatcttcttctgtccagcctatctcccta
EXON 2  138 bp
ggagaggaggggaaagaaccaagattagcagtaggatcaacatatattttaatgttttct
gtatttttattacttgtataatttaaacattttaaattagtaataatgaacaatcatgaa
actatggatgatttagtccagcaaaatatccaattgggaaccctcatccttctgacgcag
AGCCCAAATGGCGCAGTGGGAAATGCTGCAGAATCTTGACAGCCCCTTTCAGGATCAGCT
GCACCAGCTTTACTCGCACAGCCTCCTGCCTGTGGACATTCGACAGTACTTGGCTGTCTG
GATTGAAGACCAGAACTG
gtgaggccttcaggaagttgggggaatgaaaaaggtggttccttacttctgggcccccgg
gatcctggaatcattaatggcaggaaggggttggaaagcctcaggactacagtaacactg
cagagacactaatacttcttattcctggtgcccaggcaggaagctgcacttgggagtgat
EXON 3  154 bp
ctgtctggattgaagaccagaactggtgaggccttcaggaagttgggggaatgaaaaagg
tggttccttacttctgggcccccgggatcctggaatcattaatggcaggaaggggttgga
aagcctcaggactacagtaacactgcagagacactaatacttcttattcctggtgcccag
GCAGGAAGCTGCACTTGGGAGTGATGATTCCAAGGCTACCATGCTATTCTTCCACTTCTT
GGATCAGCTGAACTATGAGTGTGGCCGTTGCAGCCAGGACCCAGAGTCCTTGTTGCTGCA
GCACAATTTGCGGAAATTCTGCCGGGACATTCAG
gtacttggaacggttgggagtgatggggtagcactgggagctgagcatagaggagtaagg
tttggagaatagaatagtacctggaggtggaaagggagacgggaacaaatgtggggaaag
gaggacagagtctggacttggggaatcactagcagagagaagggttgcatatacgtgaca
EXON 4  96 bp
ctagcagagagaagggttgcatatacgtgacactgttgggaggatgctatggtgaaaaga
caaagggctaagaaccccgaaggaggaggaaatactgtggacattggtggggagggtcta
gggcaataggtcattgagagtggttgaattggatcaatcctttctgtttacctattctag
CCCTTTTCCCAGGATCCTACCCAGTTGGCTGAGATGATCTTTAACCTCCTTCTGGAAGAA
AAAAGAATTTTGATCCAGGCTCAGAGGGCCCAATTG
gtgaggacaattcagtggtaatgttggaaactcctgaagtagagaggaaccatggaaagg
actcagggagttgtctcagaacaggatccccccgacatcctgtggtataatttcaggcct
gaacttaaggcatgaaaggccagagttaaaacgtgctcagagcctcttttttcaggaaca
EXON 5  90 bp
aattggtgaggacaattcagtggtaatgttggaaactcctgaagtagagaggaaccatgg
aaaggactcagggagttgtctcagaacaggatccccccgacatcctgtggtataatttca
ggcctgaacttaaggcatgaaaggccagagttaaaacgtgctcagagcctcttttttcag
GAACAAGGAGAGCCAGTTCTCGAAACACCTGTGGAGAGCCAGCAACATGAGATTGAATCC
CGGATCCTGGATTTAAGGGCTATGATGGAG
gttagtagatgtggtaggagttagggttgacagcgttcagcctaacacctccctgagaag
cagcctcatcggggtcctctcccctctgcagaagctggtaaaatccatcagccaactgaa
agaccagcaggatgtcttctgcttccgatataagatccaggccaaaggtaggaagcacat
EXON 6  76 bp
aacaaggagagccagttctcgaaacacctgtggagagccagcaacatgagattgaatccc
ggatcctggatttaagggctatgatggaggttagtagatgtggtaggagttagggttgac
agcgttcagcctaacacctccctgagaagcagcctcatcggggtcctctcccctctgcag
AAGCTGGTAAAATCCATCAGCCAACTGAAAGACCAGCAGGATGTCTTCTGCTTCCGATAT
AAGATCCAGGCCAAAG
gtaggaagcacattgaggggctggagaaagataagtgcctgctgagaagccggagctgga
agtgaacaggagaaagctccgatgagcagtagtcactgtcagacacaccccactgactac
agtcctgctgccgtgcaaagctggaagtgctttgtggaggctgagctggaggtgcagctg
EXON 7  86 bp
agggggtgtctggtccaagcatgaccattcagaatttgcctgagggtcccacaggtgcct
gtgctttgcttggtttccctttcttcctccacaaaattcctccttcctgactctgactga
gaccccagtcaggaaggagaggaaagaacccctggactgactcctgttcccaccatccag
GGAAGACACCCTCTCTGGACCCCCATCAGACCAAAGAGCAGAAGATTCTGCAGGAAACTC
TCAATGAACTGGACAAAAGGAGAAAG
gtgggagacagaggacagaacatgtgggcaacaaggacctggaaaaatgagggatgtggg
gaccctggtcctctagcgctggcttctttgtttcttcatccccagttgggtggtggaggg
tgaaagggagagatgctcaacactcacattatctctttcccaggaggtgctggatgcctc
EXON 8  149 bp
tggacaaaaggagaaaggtgggagacagaggacagaacatgtgggcaacaaggacctgga
aaaatgagggatgtggggaccctggtcctctagcgctggcttctttgtttcttcatcccc
agttgggtggtggagggtgaaagggagagatgctcaacactcacattatctctttcccag
GAGGTGCTGGATGCCTCCAAAGCACTGCTAGGCCGATTAACTACCCTAATCGAGCTACTG
CTGCCAAAGTTGGAGGAGTGGAAGGCCCAGCAGCAAAAAGCCTGCATCAGAGCTCCCATT
GACCACGGGTTGGAACAGCTGGAGACATG
gtgagaggtaccaccccaaccctcgtcctcgccatgcgctgtgatttgtaagttgcagtg
ccctgcatatagcaagagatactgttctctatttgtctctgctccccagaatgagccctg
ctccctgctgactgcagctctattctgctcctcatcctcaccacgcagggagcccagagc
EXON 9  159 bp
attttcatttcttggattatgaatcatgttgaataatcctttatatgcttcctggattct
ttttttttcttccccccagtcagtttctgactcttcacatatttacagagagatcttgga
acctggatgggggaatccaggaaactcatggattccttcttcctgaattttatcacccag
GTTCACAGCTGGAGCAAAGCTGTTGTTTCACCTGAGGCAGCTGCTGAAGGAGCTGAAGGG
ACTGAGTTGCCTGGTTAGCTATCAGGATGACCCTCTGACCAAAGGGGTGGACCTACGCAA
CGCCCAGGTCACAGAGTTGCTACAGCGTCTGCTCCACAG
gtctagaggccaggcaggaaccctgggggaaagaaggaacaagggaagccattcttacag
atactgagctatatattctctccacacctctctctcctcagagcctttgtggtagaaacc
cagccctgcatgccccaaactccccatcgacccctcatcctcaagactggcagcaagttc
EXON 10  93 bp
atcaggatgaccctctgaccaaaggggtggacctacgcaacgcccaggtcacagagttgc
tacagcgtctgctccacaggtctagaggccaggcaggaaccctgggggaaagaaggaaca
agggaagccattcttacagatactgagctatatattctctccacacctctctctcctcag
AGCCTTTGTGGTAGAAACCCAGCCCTGCATGCCCCAAACTCCCCATCGACCCCTCATCCT
CAAGACTGGCAGCAAGTTCACCGTCCGAACAAG
gttggcattccagaactcattcccacttcctttttccaaccctgccactgtgtattttct
ggctttacagctcttcccactcttggctttttcttctctttccctgcaatctccctacct
cttataatccctcttctctttttcaaacatctagtctatccggaaggttgaggttgacca
EXON 11  60 bp
ctttttccaaccctgccactgtgtattttctggctttacagctcttcccactcttggctt
tttcttctctttccctgcaatctccctacctcttataatccctcttctctttttcaaaca
tctagtctatccggaaggttgaggttgaccactttcccctatcccccttccttcccccag
GCTGCTGGTGAGACTCCAGGAAGGCAATGAGTCACTGACTGTGGAAGTCTCCATTGACAG

gtaaattggagcaggtgaagggtggccaggacacgggctgctggggtggaggagatactc
actcttcacaacagggccctagggctatctccttcctccttccaatcctacctcacagaa
attataattcatttcttttgttgaacacttactttgtgacatgcagcatgtcagctactc
EXON 12  21 bp
accagtgcactgtacaaacaaagatacaggcttagagagactgattacatctcttctcaa
ggccacatagctagtgagctcaagtcgggtttgaaccgaggtctgtctgatcccaaagac
gaaactcctaacttccatactcttttgcccaatgatttttttaaatttatttcttttcag
GAATCCTCCTCAATTACAAGG
gtaggtgcttgacaaggacactgcaaacatctgtacagtgtatgacctgcagaaccacat
tcggcagccctggtggcacaaacaaggaagagggggatttgggatatggacaaagggaga
tggcgagatctgaaatgaagtggaacttctgtttttttttttctgctgagtttttagaat
EXON 13  94 bp
atgacctgcagaaccacattcggcagccctggtggcacaaacaaggaagagggggatttg
ggatatggacaaagggagatggcgagatctgaaatgaagtggaacttctgtttttttttt
tctgctgagtttttagaataattccattccttgtctccatgtatcttcctcctggaacag
CTTCCGGAAGTTCAACATTCTGACTTCAAACCAGAAAACTTTGACCCCCGAGAAGGGGCA
GAGTCAGGGTTTGATTTGGGACTTTGGTTACCTG
gtaagaatagtttgtgacctatgcttttattactatttttatttttttgagacggagtct
cactctgtcccccaggctggagtgcagtggtgccatcttggctcacagcaacctccgcct
cccgggttcaagcaattcttctgtctcagcctcctgagtagctgagactataggcacaca
EXON 14  48 bp
tcagcctcccaaagtgctgggatcacaggcatgagccaccatagctggcctgcttttagt
ccaaaggaacaggggttgggggaagttcccagggcttgagaggtcttgaagccaaacagg
ggttccagggacactagggtgcccactctggcattttctctccttcccttcaattcacag
ACTCTGGTGGAGCAACGTTCAGGTGGTTCAGGAAAGGGCAGCAATAAG
gtgagatctggacagaggactcgaggcagggggagcttgccaaagagccttctgatgact
atgtctttggctgtcccaggggccactaggtgtgacagaggaactgcacatcatcagctt
cacggtcaaatatacctaccagggtctgaagcaggagctgaaagtgagtgaaaatggagg
EXON 15  84 bp
gggacactagggtgcccactctggcattttctctccttcccttcaattcacagactctgg
tggagcaacgttcaggtggttcaggaaagggcagcaataaggtgagatctggacagagga
ctcgaggcagggggagcttgccaaagagccttctgatgactatgtctttggctgtcccag
GGGCCACTAGGTGTGACAGAGGAACTGCACATCATCAGCTTCACGGTCAAATATACCTAC
CAGGGTCTGAAGCAGGAGCTGAAA
gtgagtgaaaatggagggcaaggagagagaaagcagctttggaagaaggcataagaaggg
gataaacagaagcctcttggggtgggttagcactcctttcctctaacaaatacctgcagc
tagaaacatcacatccctctctgtgactcctgtcttctccccagacggacaccctccctg
EXON 16  99 bp
gaagcaggagctgaaagtgagtgaaaatggagggcaaggagagagaaagcagctttggaa
gaaggcataagaaggggataaacagaagcctcttggggtgggttagcactcctttcctct
aacaaatacctgcagctagaaacatcacatccctctctgtgactcctgtcttctccccag
ACGGACACCCTCCCTGTGGTGATTATTTCCAACATGAACCAGCTCTCAATTGCCTGGGCT
TCAGTTCTCTGGTTCAATTTGCTCAGCCCAAACCTTCAG
gtaggggagtggggccgacaggtcaaggcgcgagaggaggggtgtggaagcttggtgtga
taggttgcttctgagccagcctacactgctcccacccctgcagaaccagcagttcttctc
caacccccccaaggccccctggagcttgctgggccctgctctcagttggcagttctcctc
EXON 17  136 bp
ttatttccaacatgaaccagctctcaattgcctgggcttcagttctctggttcaatttgc
tcagcccaaaccttcaggtaggggagtggggccgacaggtcaaggcgcgagaggaggggt
gtggaagcttggtgtgataggttgcttctgagccagcctacactgctcccacccctgcag
AACCAGCAGTTCTTCTCCAACCCCCCCAAGGCCCCCTGGAGCTTGCTGGGCCCTGCTCTC
AGTTGGCAGTTCTCCTCCTATGTTGGCCGAGGCCTCAACTCAGACCAGCTGAGCATGCTG
AGAAACAAGCTGTTCG
gtacagatttccttttctctcagcctttccccagccttagtcttttctgtccctctgtcc
tatctatcccaggacccctggcttccctcatcatctgtctgtggctatctgtcccacagg
gcagaactgtaggactgaggatccattattgtcctgggctgacttcactaaggtaactcc
EXON 18  53 bp
tcctatgttggccgaggcctcaactcagaccagctgagcatgctgagaaacaagctgttc
ggtacagatttccttttctctcagcctttccccagccttagtcttttctgtccctctgtc
ctatctatcccaggacccctggcttccctcatcatctgtctgtggctatctgtcccacag
GGCAGAACTGTAGGACTGAGGATCCATTATTGTCCTGGGCTGACTTCACTAAG
gtaactccctgaatcctgtggagctgctggatctagcccacattccaaatactggccttc
ccacgtccctccttccctacaccagaggcaactcctcagcttttgctacctttccattcc
tcctccagcgagagagccctcctggcaagttaccattctggacatggctggacaaaattc
EXON 19  95 bp
gcagaactgtaggactgaggatccattattgtcctgggctgacttcactaaggtaactcc
ctgaatcctgtggagctgctggatctagcccacattccaaatactggccttcccacgtcc
ctccttccctacaccagaggcaactcctcagcttttgctacctttccattcctcctccag
CGAGAGAGCCCTCCTGGCAAGTTACCATTCTGGACATGGCTGGACAAAATTCTGGAGTTG
GTACATGACCACCTGAAGGATCTCTGGAATGATGG
gtaaggccttggtcacccttccctcatgggcttgtgctttccgggcttgagagtggagtc
tctgcaccctcacgtggcaagcagggagagagagcaaagacaggtgcaggccacgtctcc
tcacatttgttaacaataataaggccgggtgtggtggctcacacctgtaatcccagcact
EXON 20  137 bp
tggctattgtcagcaaagtgaagtgacttgtaaaagataaaaaaaagctaagtggcaggg
cttggtccaaagcctggattccaaacctgggctgtttctccatacaaggggagcagggag
gcaggggcctggtggggcagggtgttgggcggtgtctcacagctgctctctgtgctccag
ACGCATCATGGGCTTTGTGAGTCGGAGCCAGGAGCGCCGGCTGCTGAAGAAGACCATGTC
TGGCACCTTTCTACTGCGCTTCAGTGAATCGTCAGAAGGGGGCATTACCTGCTCCTGGGT
GGAGCACCAGGATGATG
gtcagctgctctgccctgccattcccacagcctctcctttctgcctggctcccctcttgc
ccctctgcctgcccttggcttccctggctctgaactgaatccctcagctggtttgggact
gggcagccagagcagagagctccaaggcccggcctcttccctcaagcccgcctgttcctg
EXON 21  183 bp
cctgccattcccacagcctctcctttctgcctggctcccctcttgcccctctgcctgccc
ttggcttccctggctctgaactgaatccctcagctggtttgggactgggcagccagagca
gagagctccaaggcccggcctcttccctcaagcccgcctgttcctgcattcactctccag
ACAAGGTGCTCATCTACTCTGTGCAACCGTACACGAAGGAGGTGCTGCAGTCACTCCCGC
TGACTGAAATCATCCGCCATTACCAGTTGCTCACTGAGGAGAATATACCTGAAAACCCAC
TGCGCTTCCTCTATCCCCGAATCCCCCGGGATGAAGCTTTTGGGTGCTACTACCAGGAGA
AAG
gtgggaatcgttgacatacttcattgctagattgcagagatctaccagacatccatagat
cccactccttcctttaaagcatgggaaaactgatatctagaggaattaagggattcgtcc
atgggatactgctggttactatggggatgagactgccaggaccatctgcactaggggaac
EXON 22  58 bp
atcccactccttcctttaaagcatgggaaaactgatatctagaggaattaagggattcgt
ccatgggatactgctggttactatggggatgagactgccaggaccatctgcactagggga
acctcaggctatatgtctggcccactgatcttctctgcttcttgtatatgttcctcacag
TTAATCTCCAGGAACGGAGGAAATACCTGAAACACAGGCTCATTGTGGTCTCTAATAG
gtgagatatgaactcttcattcatcctccctaatcctttttggctctgcttcagtgaatc
gtcaaaagggggcattaccttctcctgggtggagcaccaggatgatggtcagctgctctg
ccctgccattcccacagcctctcctttctgccttctcctaagctgccctattccagtctc
EXON 23  311 bp
ttaggccacttgcctaaggtcccccagccaggattcaaactccaggaggcctgattccaa
acccatgctctttagccctccgccctactgccttcttagactagcttctgcttattctac
cattcctgatttcatttgaaccactgagccctgcccctttgtctgtctttgggtatccag
ACAGGTGGATGAACTGCAACAACCGCTGGAGCTTAAGCCAGAGCCAGAGCTGGAGTCATT
AGAGCTGGAACTAGGGCTGGTGCCAGAGCCAGAGCTCAGCCTGGACTTAGAGCCACTGCT
GAAGGCAGGGCTGGATCTGGGGCCAGAGCTAGAGTCTGTGCTGGAGTCCACTCTGGAGCC
TGTGATAGAGCCCACACTATGCATGGTATCACAAACAGTGCCAGAGCCAGACCAAGGACC
TGTATCACAGCCAGTGCCAGAGCCAGATTTGCCCTGTGATCTGAGACATTTGAACACTGA
GCCAATGGAAA
gtaagtgatgagatggagctatggaagatggcacacattccctttcctacctcttctccc
tctcccattacagaaaaagctgaactccaagctcctcattggagagaggtccattctgtg
attcctttttttaggaattacacatgccttcccccacctccctgctctttcatcccacaa
EXON 24  820 bp
ttctgtgattcctttttttaggaattacacatgccttcccccacctccctgctctttcat
cccacaagttcccactcaggctcttcccaggcctttcctgccatcctccctccctttccc
tgctgggttgggaactcctaactaagatcggggcctcacttttctctctggattacctag
TCTTCAGAAACTGTGTAAAGATTGAAGAAATCATGCCGAATGGTGACCCACTGTTGGCTG
GCCAGAACACCGTGGATGAGGTTTACGTCTCCCGCCCCAGCCACTTCTACACTGATGGAC
CCTTGATGCCTTCTGACTTCTAGGAACCACATTTCCTCTGTTCTTTTCATATCTCTTGCC
CTTCCTACTCCTCATAGCATGATATTGTTCTCCAAGGATGGGAATCAGGCATGTGTCCCT
TCCAAGCTGTGTTAACTGTTCAAACTCAGGCCTGTGTGACTCCATTGGGGTGAGAGGTGA
AAGCATAACATGGGTACAGAGGGGACAACAATGAATCAGAACAGATGCTGAGCCATAGGT
CTAAATAGGATCCTGGAGGCTGCCTGCTGTGCTGGGAGGTATAGGGGTCCTGGGGGCAGG
CCAGGGCAGTTGACAGGTACTTGGAGGGCTCAGGGCAGTGGCTTCTTTCCAGTATGGAAG
GATTTCAACATTTTAATAGTTGGTTAGGCTAAACTGGTGCATACTGGCATTGGCCCTTGG
TGGGGAGCACAGACACAGGATAGGACTCCATTTCTTTCTTCCATTCCTTCATGTCTAGGA
TAACTTGCTTTCTTCTTTCCTTTACTCCTGGCTCAAGCCCTGAATTTCTTCTTTTCCTGC
AGGGGTTGAGAGCTTTCTGCCTTAGCCTACCATGTGAAACTCTACCCTGAAGAAAGGGAT
GGATAGGAAGTAGACCTCTTTTTCTTACCAGTCTCCTCCCCTACTCTGCCCCTAAGCTGG
CTGTACCTGTTCCTCCCCCATAAAATGATCCTGCCAATCT
aatgtgagtgtgaagctttgcacactagtttatgctacctagtctccactttctcaatgc
ttaggagacagatcactcctggaggctggggatggtaggattgctggggatttttttttt
tttaaacagggtctcactctgttgcccaggctagagtgcaatggtgcaatcacagctcac