Gene RPLP0 Variant 2
DNA : 4.19 KbNT_009775
mRNA : 1130 bp NM_053275
CDS : 954 bp NP_444505
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  164 bp
ctagttagatgggcgccaggggtcgccggcgggaagcatggaggggtctttgggggcctt
tgggaacatggagtcctattctgttccgcctggggcctcggtggcggcttgcacgccccg
agatgacggccgctgccctaggcagggccggcgggcgattgcgcgtgtcctgctcctctt
AGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACCAGGCCTGAGCTCCCTGTCTCTCCTC
AGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCTGACGCACCGCCGTGATGCCCAGGG
AAGACAGGGCGACCTGGAAGTCCAACTACTTCCTTAAGATCATC
gtaagtgcagggtgggtcgcctctgctcttcatgttgccccagcgcaaatagggacagtc
agctgctatgtgctgagggtctactcacaccggctactgaattaggccatttttgggaaa
atactgtttagttaacaatttcctgagataggtcccttctgttgcagataaacgggctca
EXON 2  176 bp
acccagctagccaatcatccagtttggcagtgttacaacgtagctcccaatctccctctg
acttcaaaagcttagaagaaagggagtgggatggaaacaaattgtggggttcagtttctt
ctggcattttttccctctctcttcctgttaaacttggctcctctggcttgttttttgtag
CAACTATTGGATGATTATCCGAAATGTTTCATTGTGGGAGCAGACAATGTGGGCTCCAAG
CAGATGCAGCAGATCCGCATGTCCCTTCGCGGGAAGGCTGTGGTGCTGATGGGCAAGAAC
ACCATGATGCGCAAGGCCATCCGAGGGCACCTGGAAAACAACCCAGCTCTGGAGAA
gtcagttcccctggcagttttgtcctttctccccagtgcccgtctccctcttcctggaga
atggtgctgaaaggtgattgtctcccataaacttctctttgcagactgctgcctcatatc
cgggggaatgtgggctttgtgttcaccaaggaggacctcactgagatcagggacatgttg
EXON 3  88 bp
tggtgctgatgggcaagaacaccatgatgcgcaaggccatccgagggcacctggaaaaca
acccagctctggagaagtcagttcccctggcagttttgtcctttctccccagtgcccgtc
tccctcttcctggagaatggtgctgaaaggtgattgtctcccataaacttctctttgcag
ACTGCTGCCTCATATCCGGGGGAATGTGGGCTTTGTGTTCACCAAGGAGGACCTCACTGA
GATCAGGGACATGTTGCTGGCCAATAAG
gtaaggggacaattgggttggctaaagagactttgttgttgctccttaaagcaaaatgga
ccattctcaggttgtgtgagtggagaggcttttctcactgtttgttgtctttgtcaggtg
ccagctgctgcccgtgctggtgccattgccccatgtgaagtcactgtgccagcccagaac
EXON 4  147 bp
gtgggctttgtgttcaccaaggaggacctcactgagatcagggacatgttgctggccaat
aaggtaaggggacaattgggttggctaaagagactttgttgttgctccttaaagcaaaat
ggaccattctcaggttgtgtgagtggagaggcttttctcactgtttgttgtctttgtcag
GTGCCAGCTGCTGCCCGTGCTGGTGCCATTGCCCCATGTGAAGTCACTGTGCCAGCCCAG
AACACTGGTCTCGGGCCCGAGAAGACCTCCTTTTTCCAGGCTTTAGGTATCACCACTAAA
ATCTCCAGGGGCACCATTGAAATCCTG
gtgagtggacctggtttgcctgtgctaaccaggcaaatggggagctgcttttagtggcca
tggatctgctggttgtccaacaggtgtttactgccccactattatctggttcagagtgat
gtgcagctgatcaagactggagacaaagtgggagccagcgaagccacgctgctgaacatg
EXON 5  186 bp
aagacctcctttttccaggctttaggtatcaccactaaaatctccaggggcaccattgaa
atcctggtgagtggacctggtttgcctgtgctaaccaggcaaatggggagctgcttttag
tggccatggatctgctggttgtccaacaggtgtttactgccccactattatctggttcag
AGTGATGTGCAGCTGATCAAGACTGGAGACAAAGTGGGAGCCAGCGAAGCCACGCTGCTG
AACATGCTCAACATCTCCCCCTTCTCCTTTGGGCTGGTCATCCAGCAGGTGTTCGACAAT
GGCAGCATCTACAACCCTGAAGTGCTTGATATCACAGAGGAAACTCTGCATTCTCGCTTC
CTGGAG
gtatatgctgtcagccttgccccctcttacactgatggttgagagcatgacaaggttcag
actgagtccctgtaaccaaggactgtgttttcatctgtctacctacctcatctgtaaaat
gtcagtaacaacataagattgttgaaggattttttttttttttttttggagacagagtct
EXON 6  141 bp
ttatttgatggggctgaattgctctgccaggagcatttggtatgagatgaaatggcctct
cttgagactgagctgccaacctggcaattattgtctgctaagggttctctttattcaccc
ttacttggacttcctttcctgtagggaatctcacgtaaaatgaaatcttccctcccccag
GGTGTCCGCAATGTTGCCAGTGTCTGTCTGCAGATTGGCTACCCAACTGTTGCATCAGTA
CCCCATTCTATCATCAACGGGTACAAACGAGTCCTGGCCTTGTCTGTGGAGACGGATTAC
ACCTTCCCACTTGCTGAAAAG
gtaaaaggatcccaccaggaccacagtgggcctgactgtgacaaattagcagggtgatgt
ggccttctaccttactgcttttatagttgtattttatatagcagataattttgtgagggg
atatttgagaggttgggaggcagggaaggcgtttctcacttgagaaatgacaagagaccc
EXON 7  228 bp
ggccttaggaaccctgcctcactaggccatacccaagctgtcctgcttgggctgcttctg
acaggaaaggcttcacacggactttgatattgttggtccttaaactctaccaaggcagga
gggtggtgggtaatagaggagtgtggatgaccattttgaccacttcccccctcctttcag
GTCAAGGCCTTCTTGGCTGATCCATCTGCCTTTGTGGCTGCTGCCCCTGTGGCTGCTGCC
ACCACAGCTGCTCCTGCTGCTGCTGCAGCCCCAGCTAAGGTTGAAGCCAAGGAAGAGTCG
GAGGAGTCGGACGAGGATATGGGATTTGGTCTCTTTGACTAATCACCAAAAAGCAACCAA
CTTAGCCAGTTTTATTTGCAAAACAAGGAAATAAAGGCTTACTTCTTT
aaaaagtctctggactcttaattttgtaattttttttcctttttgacacagggtctggct
gttgcccaggctggagtgtggtggtgtaatcataactcactgcacccttgaactcctggg
atcaagggatcctcgtatctcagcctcccaagtagctgggactacaggcacacaccatga