Gene RPLP0 Variant 1
DNA : 4.40 KbNT_009775
mRNA : 1097 bp NM_001002
CDS : 1524 bp NP_000993
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  29 bp
cgaccctacttaaaggcggctttccgttggctggagtggcagcgatattatccaatggtt
gcctgtattcgttcagctttgtctgacgggcgatggcgcagccaatagacaggagcgcta
tccgcggtttctgattggctactttgttcgcattataaaaggcacgcgcgggcgcgaggc
CCTTCTCTCGCCAGGCGTCCTCGTGGAAG
gttcgtgtgctagttagatgggcgccaggggtcgccggcgggaagcatggaggggtcttt
gggggcctttgggaacatggagtcctattctgttccgcctggggcctcggtggcggcttg
cacgccccgagatgacggccgctgccctaggcagggccggcgggcgattgcgcgtgtcct
EXON 2  102 bp
ggaacatggagtcctattctgttccgcctggggcctcggtggcggcttgcacgccccgag
atgacggccgctgccctaggcagggccggcgggcgattgcgcgtgtcctgctcctcttag
gcccgggaccgcgggatgggtgtcggcgtgaccaggcctgagctccctgtctctcctcag
TGACATCGTCTTTAAACCCTGCGTGGCAATCCCTGACGCACCGCCGTGATGCCCAGGGAA
GACAGGGCGACCTGGAAGTCCAACTACTTCCTTAAGATCATC
gtaagtgcagggtgggtcgcctctgctcttcatgttgccccagcgcaaatagggacagtc
agctgctatgtgctgagggtctactcacaccggctactgaattaggccatttttgggaaa
atactgtttagttaacaatttcctgagataggtcccttctgttgcagataaacgggctca
EXON 3  176 bp
acccagctagccaatcatccagtttggcagtgttacaacgtagctcccaatctccctctg
acttcaaaagcttagaagaaagggagtgggatggaaacaaattgtggggttcagtttctt
ctggcattttttccctctctcttcctgttaaacttggctcctctggcttgttttttgtag
CAACTATTGGATGATTATCCGAAATGTTTCATTGTGGGAGCAGACAATGTGGGCTCCAAG
CAGATGCAGCAGATCCGCATGTCCCTTCGCGGGAAGGCTGTGGTGCTGATGGGCAAGAAC
ACCATGATGCGCAAGGCCATCCGAGGGCACCTGGAAAACAACCCAGCTCTGGAGAA
gtcagttcccctggcagttttgtcctttctccccagtgcccgtctccctcttcctggaga
atggtgctgaaaggtgattgtctcccataaacttctctttgcagactgctgcctcatatc
cgggggaatgtgggctttgtgttcaccaaggaggacctcactgagatcagggacatgttg
EXON 4  88 bp
tggtgctgatgggcaagaacaccatgatgcgcaaggccatccgagggcacctggaaaaca
acccagctctggagaagtcagttcccctggcagttttgtcctttctccccagtgcccgtc
tccctcttcctggagaatggtgctgaaaggtgattgtctcccataaacttctctttgcag
ACTGCTGCCTCATATCCGGGGGAATGTGGGCTTTGTGTTCACCAAGGAGGACCTCACTGA
GATCAGGGACATGTTGCTGGCCAATAAG
gtaaggggacaattgggttggctaaagagactttgttgttgctccttaaagcaaaatgga
ccattctcaggttgtgtgagtggagaggcttttctcactgtttgttgtctttgtcaggtg
ccagctgctgcccgtgctggtgccattgccccatgtgaagtcactgtgccagcccagaac
EXON 5  147 bp
gtgggctttgtgttcaccaaggaggacctcactgagatcagggacatgttgctggccaat
aaggtaaggggacaattgggttggctaaagagactttgttgttgctccttaaagcaaaat
ggaccattctcaggttgtgtgagtggagaggcttttctcactgtttgttgtctttgtcag
GTGCCAGCTGCTGCCCGTGCTGGTGCCATTGCCCCATGTGAAGTCACTGTGCCAGCCCAG
AACACTGGTCTCGGGCCCGAGAAGACCTCCTTTTTCCAGGCTTTAGGTATCACCACTAAA
ATCTCCAGGGGCACCATTGAAATCCTG
gtgagtggacctggtttgcctgtgctaaccaggcaaatggggagctgcttttagtggcca
tggatctgctggttgtccaacaggtgtttactgccccactattatctggttcagagtgat
gtgcagctgatcaagactggagacaaagtgggagccagcgaagccacgctgctgaacatg
EXON 6  186 bp
aagacctcctttttccaggctttaggtatcaccactaaaatctccaggggcaccattgaa
atcctggtgagtggacctggtttgcctgtgctaaccaggcaaatggggagctgcttttag
tggccatggatctgctggttgtccaacaggtgtttactgccccactattatctggttcag
AGTGATGTGCAGCTGATCAAGACTGGAGACAAAGTGGGAGCCAGCGAAGCCACGCTGCTG
AACATGCTCAACATCTCCCCCTTCTCCTTTGGGCTGGTCATCCAGCAGGTGTTCGACAAT
GGCAGCATCTACAACCCTGAAGTGCTTGATATCACAGAGGAAACTCTGCATTCTCGCTTC
CTGGAG
gtatatgctgtcagccttgccccctcttacactgatggttgagagcatgacaaggttcag
actgagtccctgtaaccaaggactgtgttttcatctgtctacctacctcatctgtaaaat
gtcagtaacaacataagattgttgaaggattttttttttttttttttggagacagagtct
EXON 7  141 bp
ttatttgatggggctgaattgctctgccaggagcatttggtatgagatgaaatggcctct
cttgagactgagctgccaacctggcaattattgtctgctaagggttctctttattcaccc
ttacttggacttcctttcctgtagggaatctcacgtaaaatgaaatcttccctcccccag
GGTGTCCGCAATGTTGCCAGTGTCTGTCTGCAGATTGGCTACCCAACTGTTGCATCAGTA
CCCCATTCTATCATCAACGGGTACAAACGAGTCCTGGCCTTGTCTGTGGAGACGGATTAC
ACCTTCCCACTTGCTGAAAAG
gtaaaaggatcccaccaggaccacagtgggcctgactgtgacaaattagcagggtgatgt
ggccttctaccttactgcttttatagttgtattttatatagcagataattttgtgagggg
atatttgagaggttgggaggcagggaaggcgtttctcacttgagaaatgacaagagaccc
EXON 8  228 bp
ggccttaggaaccctgcctcactaggccatacccaagctgtcctgcttgggctgcttctg
acaggaaaggcttcacacggactttgatattgttggtccttaaactctaccaaggcagga
gggtggtgggtaatagaggagtgtggatgaccattttgaccacttcccccctcctttcag
GTCAAGGCCTTCTTGGCTGATCCATCTGCCTTTGTGGCTGCTGCCCCTGTGGCTGCTGCC
ACCACAGCTGCTCCTGCTGCTGCTGCAGCCCCAGCTAAGGTTGAAGCCAAGGAAGAGTCG
GAGGAGTCGGACGAGGATATGGGATTTGGTCTCTTTGACTAATCACCAAAAAGCAACCAA
CTTAGCCAGTTTTATTTGCAAAACAAGGAAATAAAGGCTTACTTCTTT
aaaaagtctctggactcttaattttgtaattttttttcctttttgacacagggtctggct
gttgcccaggctggagtgtggtggtgtaatcataactcactgcacccttgaactcctggg
atcaagggatcctcgtatctcagcctcccaagtagctgggactacaggcacacaccatga