Gene PTPN11 Variant 1
DNA : 87.67 KbNT_009775
mRNA : 2767 bp NM_002834
CDS : 1782 bp NP_002825
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  394 bp
ttatcttacagaaagaaaagaatggaggaaaccgaggctcggagacagtaggtaatttcc
ccaaggttccacagctaatgagtggagcggcgatttgtggaacgaaatgaatgaaatcga
tgtggcagcgggcccggacgggtcggtggcgtagacgcggagcgcgcagctcacacctgg
CGGCCGCGGTTTCCAGGAGGAAGCAAGGATGCTTTGGACACTGTGCGTGGCGCCTCCGCG
GAGCCCCCGCGCTGCCATTCCCGGCCGTCGCTCGGTCCTCCGCTGACGGGAAGCAGGAAG
TGGCGGCGGGCGTCGCGAGCGGTGACATCACGGGGGCGACGGCGGCGAAGGGCGGGGGCG
GAGGAGGAGCGAGCCGGGCCGGGGGGCAGCTGCACAGTCTCCGGGATCCCCAGGCCTGGA
GGGGGGTCTGTGCGCGGCCGGCTGGCTCTGCCCCGCGTCCGGTCCCGAGCGGGCCTCCCT
CGGGCCAGCCCGATGTGACCGAGCCCAGCGGAGCCTGAGCAAGGAGCGGGTCCGTCGCGG
AGCCGGAGGGCGGGAGGAACATGACATCGCGGAG
gtgaggagccccgaggggcccggcgcgggcctcggcccggccaccgccgcgttcggttag
ccccgtccggaagggggcgccccggccgggcttcgggctcccgccccgggtcggggttgg
gggccggttccctcctcgtcccctcgccctccaggggccgggggccggccccaccgcgcc
EXON 2  123 bp
agggaaaggcagggaggaggcattgaccaaggagaagagggggaagggacagggaaggtc
ttgatttgtattttctaaaattttctactctgctcataatgcgtcttagctgtgttgttg
tggaaagtagtgctgacagtgtcttgtttttttattacttactttgtctttctttttaag
ATGGTTTCACCCAAATATCACTGGTGTGGAGGCAGAAAACCTACTGTTGACAAGAGGAGT
TGATGGCAGTTTTTTGGCAAGGCCTAGTAAAAGTAACCCTGGAGACTTCACACTTTCCGT
TAG
gtaagttggaatgaaaagagaggatcctgagagtgttttctaggtaggaagtggtaaaac
catgcttggatagcttgctgcctgcatttcgagtttgaaggccttatctgagccctgggc
tgccttcagggtttggggagtggcctcctggacatttagcagaagaggagtaaggagggc
EXON 3  195 bp
tgttgagttggttgacatgtggttatttcacccatcgtatttcttatagggaataggtaa
attcgttccttgggtttctttcaacacttaggtaaaatccgacgtggaagatgagatctg
attttactggtgtaactctttatttgtccccttgcctccctttccaatggactattttag
AAGAAATGGAGCTGTCACCCACATCAAGATTCAGAACACTGGTGATTACTATGACCTGTA
TGGAGGGGAGAAATTTGCCACTTTGGCTGAGTTGGTCCAGTATTACATGGAACATCACGG
GCAATTAAAAGAGAAGAATGGAGATGTCATTGAGCTTAAATATCCTCTGAACTGTGCAGA
TCCTACCTCTGAAAG
gtcagtaacattttagtgaccacaaagtctgctgctcccttgtgccctgagtgtcagaaa
tgcatgacggtctgtgtatgactctctgactccaaaggcttgtgactgttttttgagctg
taatctttaaagaattactaaagtgagactaatagcatcaaattattttcagagtacctt
EXON 4  193 bp
tttttcctgcctgcatgggatgcagattttctgtctcaggtgggattgatcaatcccttg
gaggaatgtgtctactttttaattgtgtttaggagagctgactgtatacagtagttttgt
gaaagaacaacatgaacccatagtagagctaaattcttttttattttttaaaaactttag
GTGGTTTCATGGACATCTCTCTGGGAAAGAAGCAGAGAAATTATTAACTGAAAAAGGAAA
ACATGGTAGTTTTCTTGTACGAGAGAGCCAGAGCCACCCTGGAGATTTTGTTCTTTCTGT
GCGCACTGGTGATGACAAAGGGGAGAGCAATGACGGCAAGTCTAAAGTGACCCATGTTAT
GATTCGCTGTCAG
gtaaatctccagttgaaaaatgggtctggcaagatgttacctttgggtgatttttctgct
gacagaagacagacaccattacattcaaagtcagattgtcttttatttatttatttattt
atttatttatttgagacagggtcttgctctatcacctacagatggggtttcaccacgttg
EXON 5  117 bp
tgctggaattactggcgtgagccactgcacccagcctattatctgtcttttgatggacat
ttaagttgtctctatatactagctattgtgaataatgctgcagtgaacatgagagtgctt
gaaaacactaatgtaacataaaggtaacaaataataaatgtcatgtgtttatcttgaaag
GAACTGAAATACGACGTTGGTGGAGGAGAACGGTTTGATTCTTTGACAGATCTTGTGGAA
CATTATAAGAAGAATCCTATGGTGGAAACATTGGGTACAGTACTACAACTCAAGCAG
gtgagcagattggaaagctcaagctttctccttaaaaacttaaaacaaatcctaatagag
aattttgcaaacatacagaggtagacagaatagtatcatcagcctccatgtacccattgc
agcttcaactatcaaatctttttttttttttttttttttgagacagtcttactctgtcac
EXON 6  114 bp
ctgaacagaaaacacggtgaaacgatttgaaaacttttattgtgaattacagggtcctat
gaaccctctgtccgtgcctttatgaatatcaacatagacatgtttttttttttttttttg
cattaacaccgttttctgtaatattttctttattttacatcaactgctgtactcgatcag
CCCCTTAACACGACTCGTATAAATGCTGCTGAAATAGAAAGCAGAGTTCGAGAACTAAGC
AAATTAGCTGAGACCACAGATAAAGTCAAACAAGGCTTTTGGGAAGAATTTGAG
gtaagttattaaaaaactgtttttacgtgagttgttatatcctatttttagtggaggaga
agttgctcttgtgtttggaattggacctgagagacttgaaactgacgtccttttttaatt
cggccattgattgacacggagcaagttgctgagagggcttcttcgaaacagaagagcatt
EXON 7  97 bp
gtgtggggattacaggtgtaagccatcacgcctgacccagatgaacattcttgtagctat
cgcacacaattctgaacatttcctaggatgaattccttaaagaagtaatgctgatccagg
cttttttctttttctgtgactctttgacacgtaataatattgacttttctttctttccag
ACACTACAACAACAGGAGTGCAAACTTCTCTACAGCCGAAAAGAGGGTCAAAGGCAAGAA
AACAAAAACAAAAATAGATATAAAAACATCCTGCCCT
gtaagtatcaatattccgctcagtaatagtcactcttggagattttgattcctagcacct
ctgtacctttcctcagggtcgtgtgctcttgttagcacatcggaggccttagcttcttta
attgcaagcagtttccaaaataatcaaccatggtgggtgttgatgacttcattcactgag
EXON 8  80 bp
tttgagacatcaggcagtgttcacgttactgttttgcttacctgggctttaatttttatg
tgtttttttttcaatcattgaatgaacaaaacttggactaggctggggagtaactgattt
gaactgttttttcctgaagcagtccaggacttatgtgaccgtggtctctttttcttctag
TTGATCATACCAGGGTTGTCCTACACGATGGTGATCCCAATGAGCCTGTTTCAGATTACA
TCAATGCAAATATCATCATG
gtaagctttgcttttcacagtgttttctgaccatacatttctagcctatttttgtatttt
aaatccttcctcatgtcctgaaagtaactttaaggtgtttgaaggattttcttcctaaat
ttctagcctgaatttgaaaccaagtgcaacaattcaaagcccaaaaagagttacattgcc
EXON 9  159 bp
gatggtgatcccaatgagcctgtttcagattacatcaatgcaaatatcatcatggtaagc
tttgcttttcacagtgttttctgaccatacatttctagcctatttttgtattttaaatcc
ttcctcatgtcctgaaagtaactttaaggtgtttgaaggattttcttcctaaatttctag
CCTGAATTTGAAACCAAGTGCAACAATTCAAAGCCCAAAAAGAGTTACATTGCCACACAA
GGCTGCCTGCAAAACACGGTGAATGACTTTTGGCGGATGGTGTTCCAAGAAAACTCCCGA
GTGATTGTCATGACAACGAAAGAAGTGGAGAGAGGAAAG
gtaaatcacagaaacttcttttctgctaaactgtttttaaagtatcagacatgtcagatt
ggccatgtttaggaattgaataaatgaattaagcttactgtaactgattctctggaaaaa
agggactaggagaaatttgattatgttattccttggtgtagttttctttatgtttcttct
EXON 10  132 bp
gaatgcctgcttttcttatttgaactcttctgtccttttctgaaaacctaacagatgcga
aacaggccattttccatgttggtggttattaagcaagacttgaacatttgtttgttgctt
gtttaggcttttatttcagagttcacagaattaactttctttttttctgatctcttccag
AGTAAATGTGTCAAATACTGGCCTGATGAGTATGCTCTAAAAGAATATGGCGTCATGCGT
GTTAGGAACGTCAAAGAAAGCGCCGCTCATGACTATACGCTAAGAGAACTTAAACTTTCA
AAGGTTGGACAA
gtaagtatattgtcgtattctagagactttgggaactgttgatggtgtgtaggaattcag
ggtcttgccgttactcatgtttgcatacatgcatgcattcgctcactcattgattcagta
gccatttattagcttccttctatgtgccaggtacagtttaagcagtactggtacattgtg
EXON 11  155 bp
gttgcctccaggattgcccaaaaggagacgagttctgggaacctcacgaagaggaccttt
cagtggaacctggggagattctcttcctctccattggatttaggaaagcttagaaccggg
tgattcctcaacctcttgatttatttaattcttttctggtttttcttggctctactccag
GGGAATACGGAGAGAACGGTCTGGCAATACCACTTTCGGACCTGGCCGGACCACGGCGTG
CCCAGCGACCCTGGGGGCGTGCTGGACTTCCTGGAGGAGGTGCACCATAAGCAGGAGAGC
ATCATGGATGCAGGGCCGGTCGTGGTGCACTGCAG
gtgacagctcctgctgcccctctaggccacagcctgtccctgtctcctagcgcccagggc
ttgcttttacctacccactcctagctctttaactgtaggaagaatttaatatctgtttga
ggcatagagcaactgcattgagggacattttgatcccaaggcatatttctcctagaccct
EXON 12  68 bp
gtttgggctgactccaaagccctatgctttttgccaacatattttcaaacataaatagac
aattttataaatagctccaaagagtagacattgtttctgttgatattaatggcttggttt
tgagtctgaaacccccatgaatgattctgttgtccctgctttttgtccttctgcccgcag
TGCTGGAATTGGCCGGACAGGGACGTTCATTGTGATTGATATTCTTATTGACATCATCAG
AGAGAAAG
gtgggtcatctggtgggcaagaagcgacagtttctgtttttagtttatggaaggaaagtg
ctcacgaaaacagtctggggaagagaggttgaatgggaaaattctttcacaaaaatctgg
gctgaagacttcagtgtgtctgcctgagaacagaagtgacactatttgagcttttggcat
EXON 13  152 bp
tagtcttctgggatcattggtattggtcagaagttcaacactgtagccattgcaacatgc
tcagttaaaacagcaaagactaaattagcattgtctctgagtccactaaaagttgtgcat
taaacaacttcatcctggctctgcagtttctctttattcttcatgatgtttccttcgtag
GTGTTGACTGCGATATTGACGTTCCCAAAACCATCCAGATGGTGCGGTCTCAGAGGTCAG
GGATGGTCCAGACAGAAGCACAGTACCGATTTATCTATATGGCGGTCCAGCATTATATTG
AAACACTACAGCGCAGGATTGAAGAAGAGCAG
gtaccagcctgagggctggcatgcggattctcattctcttgctaggcctcttggatacgc
tctccttttgagcaggaggacaggctctgatagacaactgtttgatttcggaatgggaaa
caaactcccaactaaaagggcctctggaaactgtcaattattctccacttctcagctctg
EXON 14  113 bp
atttaccttgagaaggtgaatcccctaacaatttggtcaatgtatcagtattctcaaccc
gtctatcaatttttttttctttctccctcttttttctttttttgggcaaaataccttttt
tgctttttatccccttaaaataaccattgtccctcacatgtgcactcttccaaatttcag
AAAAGCAAGAGGAAAGGGCACGAATATACAAATATTAAGTATTCTCTAGCGGACCAGACG
AGTGGAGATCAGAGCCCTCTCCCGCCTTGTACTCCAACGCCACCCTGTGCAGA
gtaagtagtgctgaaggaaattctttttacctggtcatggtggtttaaaaaggtttaaaa
aacaaaaacaaaaacaaaacacaagtttgtagcacatgcctttcactggtgcacgttcct
gttgccctactgttagtgtatctgtgactggtgatatctattgattgtgttaatgctatc
EXON 15  102 bp
attatattgctgtatggctatctcttctctccctgggaatgtcaggtcctaggcacagga
actgtgtctgtaccatatctggtgcccaaagaatgtagtatgtgttttatagatatcatg
taagcttaaacagcgtggtctacatttttgtaaatgtctttctttttcttttctctccag
AATGAGAGAAGACAGTGCTAGAGTCTATGAAAACGTGGGCCTGATGCAACAGCAGAAAAG
TTTCAGATGAGAAAACCTGCCAAAACTTCAGCACAGAAATAG
gtatttaaatgcaagtgctctattggttaattgtttatataattggcagtatttttaagc
aggcaagcaatttgggaatgttttagcaaagtgtaccataattgagttttacaaaccagg
ctcctttttcctctccctgtacttctttttccaagatggttttagtttagagttcattaa
EXON 16  573 bp
aaactccatctcaaaaaaaaaaaaaaaaaaaaaaaaactcagtgtcagtatttcatgtcg
aaattccacttcaatgggtagtgtagttaaaagctctaagtctaccttaaaatcacctaa
tgctttgttaagcttttagatatatgttccttaaaaactcttaacttatttcttccccag
ATGTGGACTTTCACCCTCTCCCTAAAAAGATCAAGAACAGACGCAAGAAAGTTTATGTGA
AGACAGAATTTGGATTTGGAAGGCTTGCAATGTGGTTGACTACCTTTTGATAAGCAAAAT
TTGAAACCATTTAAAGACCACTGTATTTTAACTCAACAATACCTGCTTCCCAATTACTCA
TTTCCTCAGATAAGAAGAAATCATCTCTACAATGTAGACAACATTATATTTTATAGAATT
TGTTTGAAATTGAGGAAGCAGTTAAATTGTGCGCTGTATTTTGCAGATTATGGGGATTCA
AATTCTAGTAATAGGCTTTTTTATTTTTATTTTTATACCCTTAACCAGTTTAATTTTTTT
TTTCCTCATTGTTGGGGATGATGAGAAGAAATGATTTGGGAAAATTAAGTAACAACGACC
TAGAAAAGTGAGAACAATCTCATTTACCATCATGTATCCAGTAGTGGATAATTCATTTTG
ATGGCTTCTATTTTTGGCCAAATGAGAATTAAGCCAGTGCCTGAGACTGTCAGAAGTTGA
CCTTTGCACTGGCATTAAAGAGTCATAGAAAAA
gaatcatggatatttatgaattaaggtaagaggtgtggcttttttttttttcttttttcc
agccgttgaccaattatagttcggctgttgactgagaagtttgtggtgggaaaacgtttg
ccatattttctttgcatttgaataattgtcttgtacttagaaaaaaggcgtctatgaatg