Gene PLA2G1B Variant 1
DNA : 5.67 KbNT_009775
mRNA : 560 bp NM_000928
CDS : 447 bp NP_000919
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  70 bp
gttgctaaggacaaatgcataacatattttccagtgatcccatgctggcaaatcgtcagg
gtcattcctgcaacagacagattcaaggccagccccaaactcagccaagagcaaagcaaa
cactccagccttatctgggcagggttgtgtggagactgactataagactatacctgagac
TGGTCATCTCAGTTCTTTTCTCACCTTGACTGCAAGATGAAACTCCTTGTGCTAGCTGTG
CTGCTCACAG
gtaggcaagtctccccggctccacccgcctttctctcccaagtgagctaagatctcactc
ctctggaatgggggccacaggccacagcaaacagggatggccagccccgcagtctcaatt
cgaggttcccagtggggcttaagggctcctctattggggttccctcaaggctggcacttt
EXON 2  160 bp
ttaaaaaaaaaaaaaaacctctacccactttcactttaccaggttcctgggtccaacggt
cttcagaggaggcagctggcaggggtcagggaggcagcgtgggacccgagggagcaggaa
ggcagtgtgtccccggggtgctggcagaccgatttgaactctggctatgtcttcttgcag
TGGCCGCCGCCGACAGCGGCATCAGCCCTCGGGCCGTGTGGCAGTTCCGCAAAATGATCA
AGTGCGTGATCCCGGGGAGTGACCCCTTCTTGGAATACAACAACTACGGCTGCTACTGTG
GCTTGGGGGGCTCAGGCACCCCCGTGGATGAACTGGACAA
gtaagtgatccgcctgcaggaaaattggagtgcctgccgggggcggggtggggcacacgc
caaggatctcacgaggcatacaaaggggacttgcatatctgctaaggataacatattttc
acctcttgtcaaataaacaaatatgttccaagaggaccctgtagcgaacgcaccccgtta
EXON 3  128 bp
aaaaaaaaatgctttcaataaatatatgataaaaggacttatattttttcaagccatagg
atcatttctcctgaagcatcttggcgaagtcatccccacctgttcctgagagtgggcagg
tgagggctgacctattgctctgcacttactcctatctcagctgtccctcccactttccag
GTGCTGCCAGACACATGACAACTGCTATGACCAGGCCAAGAAGCTGGACAGCTGTAAATT
TCTGCTGGACAACCCGTACACCCACACCTATTCATACTCGTGCTCTGGCTCGGCAATCAC
CTGTAGCA
gtaggtttatcccttccttgacctatgaattctagttggttctcagtaggccggggggaa
ataatagtaacaacagccatgatttagtgttaattttcttggttctgggcagtgtctcct
ttaatcctcagaacaacactatgggataggtacaattatcctcacttaacagataagaaa
EXON 4  202 bp
tgtttatctgaaagtcaaatttaactgggcatcctgatgtacttgtattcacttaatctg
tcagccctaaatgtgcatcagtggaatggctgccagcttattccagttaattcttcttgc
cccagattgtacaaaacagggtccaccttggctcagtcctctcctttcatccctctccag
GCAAAAACAAAGAGTGTGAGGCCTTCATTTGCAACTGCGACCGCAACGCTGCCATCTGCT
TTTCAAAAGCTCCATATAACAAGGCACACAAGAACCTGGACACCAAGAAGTATTGTCAGA
GTTGAATATCACCTCTCAAAAGCATCACCTCTATCTGCCTCATCTCACACTGTACTCTCC
AATAAAGCACCTTGTTGAAAGA
cctcatgtttggatattgttttattctctgtctataaactaggtctctgcctactctttt
atttttatgtatttattttttctaggtggagtcttgctctgtggcccaggctggagtgca
gtgatgccaccttgcctcactgcaacctccgcctcccgggctcaagcaatcctcccgcct