Gene PDE1B Variant 1
DNA : 29.62 KbNT_029419
mRNA : 3174 bp NM_000924
CDS : 1611 bp NP_000915
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  153 bp
gtctgtgtgtgcccccggcttccaatcgttcctttgggagggggaggagtggctgtgagg
agtgagagactggcgggcaggctgaggagaagggagggagagcagagggaggggggaacc
cggccgggggaggaggagagaggcgaggaggcggctctggcagcgcgcggcggcggcggc
GGTAGCGGCAGCAGCAGCGGCGGTGCGGAGAGCTTGGACTGGGAGCCCAAAGCTCGGCTG
GGCAGCGGGAGAGGAGGAGCCGCAGGAGCTGCAGCTCTGCCAGCTTGGGCCGAGCCTAGA
GACACCGGCCTGGCTGGTCCACGCCAGCCGCAG
gtgggaagggcctgggatggggggtgagggtctctcggctggggctgaagctgagccgag
gtgctgtctcctccttctgttccgtagaccgtggctgagcatggagctgtccccccgcag
tcctccggagatgctggaggagtcggattgcccgtcacccctggagctgaagtcagcccc
EXON 2  126 bp
ggcagcgggagaggaggagccgcaggagctgcagctctgccagcttgggccgagcctaga
gacaccggcctggctggtccacgccagccgcaggtgggaagggcctgggatggggggtga
gggtctctcggctggggctgaagctgagccgaggtgctgtctcctccttctgttccgtag
ACCGTGGCTGAGCATGGAGCTGTCCCCCCGCAGTCCTCCGGAGATGCTGGAGGAGTCGGA
TTGCCCGTCACCCCTGGAGCTGAAGTCAGCCCCCAGCAAGAAGATGTGGATTAAGCTTCG
GTCTCT
gtaagtccccggcccgggaatggggggaagggaccttagggagcctgagcgggaggagga
ggggggataactggagcagggctgtgggctggtagattctctttggcacagatgttggca
ggtgcgaggaagcacggccctgacacgcgtggccaggccacatgtgcaaggcatgtgcgg
EXON 3  114 bp
agtggcaatagcctgagattaaaaaagaaacattagctgctattattattaatgttagaa
tgattaactatttacaaaagactgaggatgtttctgtaaaatgtaccttattagggagta
tgctgttctcatgataaggtagctgtgcctaagcagcctctctgtatctgctccctgcag
GCTGCGCTACATGGTGAAGCAGTTGGAGAATGGGGAGATAAACATTGAGGAGCTGAAGAA
AAATCTGGAGTACACAGCTTCTCTGCTGGAAGCCGTCTACATAGATGAGACACG
gtgagagagaccgacagacagagaaggagaaagatgtcagacatagtgttccagagagag
gggttaagacaaagatagacacatgtggcatggacagagaccggaagaaagagagagggt
ggaccagatataaagagctctaggtagtggctcacacctgtaatcctagcactttggagg
EXON 4  183 bp
tttcattattggagatgttagataaagaaataaaaagatatagagaaagaaaggaaacag
ggttgaagacagagagctggcatgagagttactaaatgtggggtatggctgggtacaggg
tctctaggctgtggaagcacctgctgtctttcctctgtgactccccttctggggtctcag
GCAAATCTTGGACACGGAGGACGAGCTGCAGGAGCTGCGGTCAGATGCCGTGCCTTCGGA
GGTGCGGGACTGGCTGGCCTCCACCTTCACCCAGCAGGCCCGGGCCAAAGGCCGCCGAGC
AGAGGAGAAGCCCAAGTTCCGAAGCATTGTGCACGCTGTGCAGGCTGGGATCTTCGTGGA
ACG
gtgaggctcgcccacactcagcctccctctgcctttagctgtgcccctctttcccagcca
ccctggtcttccatgaccaccagccatatgatcccatggctcatccccacatccccagct
ggccacacctccactcccagaccttcatatgtgggcttcttctcattgttctctctcagg
EXON 5  67 bp
ggtgaggctcgcccacactcagcctccctctgcctttagctgtgcccctctttcccagcc
accctggtcttccatgaccaccagccatatgatcccatggctcatccccacatccccagc
tggccacacctccactcccagaccttcatatgtgggcttcttctcattgttctctctcag
GATGTTCCGGAGAACATACACCTCTGTGGGCCCCACTTACTCTACTGCGGTTCTCAACTG
TCTCAAG
gtaatctctgggtttttgggaaagaggagaaagttaggggatggaatagccactgggact
tctagaccctgtttatggcattatttttgccttccttttttttttttgaaatggagtctc
gctcttgtcactcaggctggagtgcagtggcgtgatctcgtctcactgcaacctctgcct
EXON 6  117 bp
caaactcctgccttcctgtctctcccatactgagagatatatgggaagaaagaggcacac
tttaccatttctttgctttcctatttaccaagactttgtactcatgggaagtccttcttg
aagtctaacttcaacccttgctgctgctggaaagccacataatctattgtttctccatag
AACCTGGATCTCTGGTGCTTTGATGTCTTTTCCTTGAACCAGGCAGCAGATGACCATGCC
CTGAGGACCATTGTTTTTGAGTTGCTGACTCGGCATAACCTCATCAGCCGCTTCAAG
gttgggcagcatcctacctctacctccaggcaggattctccactcctctcatgcctgttc
taaaagcctcccaacaaacagattccatagatcccctcactcagtctcaacatcagggaa
gtctccccatgcccacgcccagcctagcctttctttcacttgctgcagtcttagttccag
EXON 7  141 bp
cccaaggttgcacagccagcaggtggtagaggcaggatatgagccaggttcacctaacta
ggttctgtgctctctccctatgccacactgccttctaaagaaagttgttgatctcggtcc
gtaatcaccaccattcctgtggatccttgatatatctccatttcccctaactccccgcag
ATTCCCACTGTGTTTTTGATGAGTTTCCTGGATGCCTTGGAGACAGGCTATGGGAAGTAC
AAGAATCCTTACCACAACCAGATCCACGCAGCCGATGTTACCCAGACAGTCCATTGCTTC
TTGCTCCGCACAGGGATGGTG
gtaggtgccctggagatgattcttctgtgattcagggcctatggctacagaactgggagg
tctagactgtactcccatttccatttctcctcgttggttcttcttgggcactccaaagcc
ttgacagagccaaactggattaactcactctagagaattcccaggtagactaaaactcgt
EXON 8  101 bp
ggttcggatggaggaaggtccttggccatttcaggagctgagaaacctggctgcattaac
caagagctggcctggaagcatggaagggatgggatgagtgatctagcctgtgtgtggagg
ttcctgggaagtgaccagcaggcgtcacccctctctcattctttctctttcctcctgtag
CACTGCCTGTCGGAGATTGAGCTCCTGGCCATCATCTTTGCTGCAGCTATCCATGATTAT
GAGCACACGGGCACTACCAACAGCTTCCACATCCAGACCAA
gtgaggggtggggatgtggcaggggcaggaggggccaagaggaggtggggaggttgccgg
agtccctccttacagggggtggtcatgatgacctttggctttgtaggtcagaatgtgcca
tcgtgtacaatgatcgttcagtgctggagaatcaccacatcagctctgttttccgattga
EXON 9  126 bp
gccatcatctttgctgcagctatccatgattatgagcacacgggcactaccaacagcttc
cacatccagaccaagtgaggggtggggatgtggcaggggcaggaggggccaagaggaggt
ggggaggttgccggagtccctccttacagggggtggtcatgatgacctttggctttgtag
GTCAGAATGTGCCATCGTGTACAATGATCGTTCAGTGCTGGAGAATCACCACATCAGCTC
TGTTTTCCGATTGATGCAGGATGATGAGATGAACATTTTCATCAACCTCACCAAGGATGA
GTTTGT
gtgagcagaagccagtacttggcatccctaagagactcccttaccacaaactccattttc
cacttcctggacctcctgcccagcagcgctgaggggactgattgcttctctttttatgtc
cgctcagagaactccgagccctggtcattgagatggtgttggccacagacatgtcctgcc
EXON 10  102 bp
atgcaggatgatgagatgaacattttcatcaacctcaccaaggatgagtttgtgtgagca
gaagccagtacttggcatccctaagagactcccttaccacaaactccattttccacttcc
tggacctcctgcccagcagcgctgaggggactgattgcttctctttttatgtccgctcag
AGAACTCCGAGCCCTGGTCATTGAGATGGTGTTGGCCACAGACATGTCCTGCCATTTCCA
GCAAGTGAAGACCATGAAGACAGCCTTGCAACAGCTGGAGAG
gtggcatctggtggggtgtggctggggccaggccagagggaggggtgtgtgaactggggg
ggtatacacaagggtagttggtgtgccaggtctttacctcgctgtagagactccactggc
ttcaggtatcagactgcatctctatgtgagagagagagagagtgtgtgtgtgtgtgtgtg
EXON 11  121 bp
tgagctgagattgtgccactgcactccagcccgggcaacagagtgagaccctgtctcaaa
aaaaaaaaaaaaaaaaggaagaagttatgtgatagggtgtgcgtgggaagttagggaatg
gtcctaacttccttttcctaaaagatcagtctcccttcccttgccatctgccccaaccag
GATTGACAAGCCCAAGGCCCTGTCTCTACTGCTCCATGCTGCTGACATCAGCCACCCAAC
CAAGCAGTGGTTGGTCCACAGCCGTTGGACCAAGGCCCTCATGGAGGAATTCTTCCGTCA
G
gtagcgtggcatctttgccttccctgtgcctatgggggccttctctccccttttgccctc
caagttccccaatcctgttccacatcctccttttgctacctgtagtctctgacctgatcc
caaatccttggggtaaaaccccattatcctaaaagcctaacaatagttgcatttcatttg
EXON 12  82 bp
aagcctaacaatagttgcatttcatttgcatatatttcatttgcatattactaatttcca
ggtcaacagtgcagaaatttcacacaacaaccccccacccccaccacttgccacctgtac
cccagatctggtaggtctgaggtatcctctccagctttcctaccctgttccctcctctag
GGTGACAAGGAGGCAGAGTTGGGCCTGCCCTTTTCTCCACTCTGTGACCGCACTTCCACT
CTAGTGGCACAGTCTCAGATAG
gtgagtgtcctctcctgcaggaaggggaggactgggagggggaaaagatgctgcctgggt
caggattgctccaagtcctcaatccccccaaaccattcttcctgtagaggaaagcctact
gtgctagagcatggggtcctgggttaggaggccagggggctgcaatggcaggaaggagct
EXON 13  109 bp
tctctggggcaccaagacatcatcccaaagcctgccctgcattgggaagttttcagcccc
aggttacctctccatcctctttcataagcagccaggggtcctggccatgccagctgcatg
ctctgcctagccctccagataatagtaagacatctctacggcattgctcctccactgcag
GGTTCATCGACTTCATTGTGGAGCCCACATTCTCTGTGCTGACTGACGTGGCAGAGAAGA
GTGTTCAGCCCCTGGCGGATGAGGACTCCAAGTCTAAAAACCAGCCCAG
gtgagggtggctggggtagccagatatcttggttcaggaaggcagtggtagggagggatt
tggactcacagagaggaccgactcacagccatggtggggtggtggggaggcagactgctt
caagcttgggagtccctctgccgtcagggacagaaggatgggatcagaagggtgtgacct
EXON 14  131 bp
ggaggggtgaaatgagggggagagggacagggacttggggaatatctagtagaggaaaag
aggaagatgaagttccctgaaccttctcctggtcttccatgtcctgcactcccagggcta
aggtggttctggagtgggctggggcttacctcttgcggcttttgggggttctgcttctag
CTTTCAGTGGCGCCAGCCCTCTCTGGATGTGGAAGTGGGAGACCCCAACCCTGATGTGGT
CAGCTTTCGTTCCACCTGGGTCAAGCGCATTCAGGAGAATAAGCAGAAATGGAAGGAACG
GGCAGCAAGTG
gtgggtaccatggcagagggcaggggtgagaacttgtgtgggtggatcatggagcactag
gaggtccatttttcttaagcccctggggaaaccctttgccggactccttgatttgggagt
ggagctgatcagaccagttagatcacaggaaagactggctgagtggcctggaatgttcta
EXON 15  121 bp
gagggttctgagttttagcaaggctggagaggctcttcccaagtggggatgggttgaatg
tagttcagcttgaaggcaggttgatggatgagaatcccttacatgtctccacatactcct
tgggttctggggaagaatacttcttggcctaagctcagcctcctttatgctcctctacag
GCATCACCAACCAGATGTCCATTGACGAGCTGTCCCCCTGTGAAGAAGAGGCCCCCCCAT
CCCCTGCCGAAGATGAACACAACCAGAATGGGAATCTGGATTAGCCCTGGGGCTGGCCCA
G
gtgagcctgttgtggtggagggtgtaggagagctggtgtctatcatggcatctttgttgg
gtcgtctctgggctccagtggatgcgacattctctctccccttttgagcagtaaaatgga
gcgagtgaagacatagaatggagccaaagtgtgggtggagcagggaaatcctcccacgct
EXON 16  1380 bp
gcagctgaacgtgacttcgacttcagcccctattcacccccttggctgggcacccttctg
aagggcattttttgcacagctctactcgggactgagtggggatcaggacttggagaagga
aggtcaggttggaggtgaaggcaaagctcagggcactgaagtttctccctctttccccag
GTCTTCATTGAGTCCAAAGTGTTTGATGTCATCAGCACCATCCATCAGGACTGGCTCCCC
CATCTGCTCCAAGGGAGCGTGGTCGTGGAAGAAACAACCCACCTGAAGGCCAAATGCCAG
AGATTTGGGGTTGGGGAAAGGGCCCCTCCCCACCTGACACCCACTGGGGTGCACTTTAAT
GTTCCGGCAGCAAGACTGGGGAACTTCAGGCTCCCAGTGGTCACTGTGCCCATCCCTCAG
CCTCTGGATTCTCTTCATGGCCAGGTGGCTGCCAGGGAGCGGGGAGCTTCCTGGAGGCTT
CCCAGGGCCTTGGGGAAGGGTCAGAGATGCCAGCCCCCTGGGACCTCCCCCATCCTTTTT
GCCTCCAAGTTTCTAAGCAATACATTTTGGGGGTTCCCTCAGCCCCCCACCCCAGATCTT
AGCTGGCAGGTCTGGGTGCCCCTTTTCCTCCCCTGGGAAGGGCTGGAATAGGATAGAAAG
CTGGGGGTTTTCAGAGCCCTATGTGTGGGGAGGGGAGTGGATTCCTTCAGGGCATGGTAC
CTTTCTAGGACCTGGGAATGGGGTGGAGAGGACATCCTCTTCACCCCAGAATTGCGCTGC
TTCAGCCCCATCTCCAGCCTGATCCTCTGAATCTTCCTTCCCTCCCTTTCTGATACAGTG
ACTGGGGCAAAAGGAGCCATTGTGACCAGGGGCTGCGGGAGGCCTTTCCTGGGACCTTCC
TTGGGACTGGTCTGGGCCCCTGGGGCTTGTCGCCTGCCCTGAGTCCGGAGCCCTTTGCCT
CCTTCCTCTCCCCTGGGGCTGGGAGGCTCCATCCGACCAATGTCTGTAAAGTGCTTTGAG
GATCTCCCCAGCAAAGCACCTTCAGAATGTATCGACACCAGCTGGGTTAGGGTCAAGGGT
GCCTGGGGAGGGTGAGTAATCCTGCATTGCTAAAAGAGAGGGTCTGTCCCCTCCTCTCCA
CGTCCCAGAACTGGCCCAGCTGCAGGCACTAAGAAGCTCCTCCCCTGAGACAAGTGAGGG
GTAGTCGGTGAAAGGCAGATGGACAAGGGGCTCAGGGCTGCTGCCTTCCTGTCCTCTGGA
GAGAACCCAGCCAGGCGCGGTGCCCCTTCCTCTCCTCAGGCTCCTCCTTGCCCCCACCTT
GCCCCAGGAAAGGCCAAAGTCCAGGTGACTGCCCTCCTTCTTTCTTGTAAATACCAACCA
TGCATTTGTACAGTGGGCCCTGTTCATGCGAAATCCACATCCATGGTCTCCTAGACCTGC
TACCCTGGTACTTCCACCCTACCCCACCCCGAGAAGGGCAGAGACGCATGTGACTCACCC
CTGCCCTTGGTTTCCCAGACCCCTGCTATAGCCAGAGAACAATAAAGAAGGGAGACCAGG

cctgactgtgtgtgttcactgggtacaagttgaccaagcatcttcacatacatacactct
ttccagcatgataaaatctgggtgaggcgttctccctcatatatatatatatatatattt
aggtatgtatctgggcaagctgaggcccaggaggaggccccgagggctcatagtagctgc