Gene NTN4 Variant 1
DNA : 132.95 KbNT_019546
mRNA : 3615 bp NM_021229
CDS : 1887 bp NP_067052
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  504 bp
ccccccccccgggcggcagcggcagcggcgatccgatcccgcgggctgcgccgcccgggc
tgtcaagcgcggggggcgggcgggaggaaggggtggaggtgcgaggggaggagggctggc
accggagcgccgcggcgtcggtgcaataaaaatgcatcgcatggaactgcccgtggagaa
GGACGGGACGGAGCCGGGGCAGCCAGAAGAGGTGGGAAAAGCGGAGGAGGACGCCCAGGA
GGAGGCGGCGGCGGCGGCCGGGAAGTGAAAGGTCTCGCAAAGTTCAGCGGCGGCTGCGGG
CGCCGAGCCCCGGGCTAGCGGCAGACGAGCCCGCAGGGCCGCTCCGCGGGGCAGCGCAGC
CAGGCCGGCTATGGTCCCGGGGCTCCCGCCGCCCCCCAGGTGCCCGGGACCCGCCAGGCC
GGTGCGCGAGGGTCACCCCACCTCCCCGCGCGGTCCCGGCCCCTGGCTCCCAGCTGCCGG
CGACCGCTGACCGAGCCCGGCGCCCCAGGAGGAGGAAGAAACCAGGGCCCCGTTCCCTCC
CGAGGACGGCGGCGCTTCATCCCGCAGCCCAGAGGTCTCGGCTCCCTCCGGCACCCGCCC
GGCCCGGCTGCTCCCGGCTCCTCCCGGCCATGGGGAGCTGCGCGCGGCTGCTGCTGCTCT
GGGGCTGCACGGTGGTGGCCGCAG
gtgggtggtgacgcggcggggcccccaccccttccctcgctgcttctctaacccatctcg
ggactcgggggtgcaggggagccagggctgcgagcgcagagcgctgctcccgagggtgaa
atgagtggccatgttccgcctcctttccccggggctccgcagtttcaaatactattgatt
EXON 2  530 bp
gtgaatgcagaacagtgttcatgctcaaacaggaacatggtggagcatggtagaatttgc
catttatcgaaagtctcaagcgcttttggggagatccttgactgttgttgatggactagg
tggccaaaagagctttccagatgggtttgtcttgcatcatgcatgctttccctttcttag
GACTGAGTGGAGTAGCTGGAGTGAGTTCCCGCTGTGAAAAAGCCTGCAACCCTCGGATGG
GAAATTTGGCTTTGGGGCGAAAACTCTGGGCAGACACCACCTGCGGTCAGAATGCTACCG
AACTGTACTGCTTCTACAGTGAGAACACGGATCTGACTTGTCGGCAGCCCAAATGTGACA
AGTGCAATGCTGCCTATCCTCACCTGGCTCACCTGCCATCTGCCATGGCAGACTCATCCT
TCCGGTTTCCTCGCACATGGTGGCAGTCTGCGGAGGATGTGCACAGAGAAAAGATCCAGT
TAGACCTGGAAGCTGAATTCTACTTCACTCACCTAATTGTGATGTTCAAGTCCCCCAGGC
CGGCTGCCATGGTGCTGGACCGCTCCCAGGACTTTGGGAAAACATGGAAGCCTTATAAGT
ACTTTGCGACTAACTGCTCCGCTACATTTGGCCTGGAAGATGATGTTGTCAAGAAGGGCG
CTATTTGTACTTCTAAATACTCCAGTCCTTTTCCATGCACTGGAGGAGAG
gtaagggcacctgtttaactctacactgtaagtaagatagaaaaatgttaccagcccgca
tttttttttaaagcatgaagctatacttgtagcaacatgaatgaaattagaatttttcat
gagatttatttgtcataaattatttcttacccttacatatgaatgtgtagtcattttcaa
EXON 3  279 bp
tctgctccttagaataacagggcggctctgtcccaggtgtgctcaaggtctaaaaacttc
ttgttatcttatcgttcacagatgacataaggcataaatcaaacagggactacattaggc
aaacaattcagggtttgcgcacagtcctataaacgcatggtattttctttctccttacag
GTTATTTTCAAAGCTTTGTCACCACCATACGATACAGAGAACCCTTACAGTGCCAAAGTT
CAGGAGCAGCTGAAGATCACCAACCTTCGCGTGCAGCTGCTGAAACGACAGTCTTGTCCC
TGTCAGAGAAATGACCTGAACGAAGAGCCTCAACATTTTACACACTATGCAATCTATGAT
TTCATTGTCAAGGGCAGCTGCTTCTGCAATGGCCACGCTGATCAATGCATACCTGTTCAT
GGCTTCAGACCTGTCAAGGCCCCAGGAACATTCCACATG
gtaggtgaaacaagtcctcccctaagaaaaacaaatcataagttaccttcagctttgggc
attggttggtatatgcttaacatagtgctgctgattttttcctctgcccatcacagctcc
gactccatactcatcctataaagtgcctgttaacttgtcttttaatcttcagttttagag
EXON 4  126 bp
ttcaaaagatgataagacaaactaaagaaagcatctctcctcttgatggctaacttcttc
aggaaagtgaatgaacatcttatgactaaagccaatccatgagattagattgtgggaagc
atgttctgttcttctttggcgacatgtgtgctcatagttctcacttgatgttgcttgtag
GTCCATGGGAAGTGTATGTGTAAGCACAACACAGCAGGCAGCCACTGCCAGCACTGTGCC
CCGTTATACAATGACCGGCCATGGGAGGCAGCTGATGGCAAAACGGGGGCTCCCAACGAG
TGCAGA
agtaagtaacaagcccacgatactcaaaagctttctttgtaaagtcaacgcatctgtgga
ctccttgttgtctctagaaatacaacacaaagtggtgggtgacaaacactagaccctaca
caaacatagccatatcactgcccactgaggcttcagccactgaaaacagttgccgttcat
EXON 5  190 bp
gctggtctcaaactcctggcctcaggtgatccacctgcctcagcctcccacaagtgctgg
gattacaggtgtgagctaccacgcctggccaactcatcctatttttacctatctgaatat
gagataacccatcattttatttttacttattagtgtttctctccacgcttcttatttcca
GCCTGCAAGTGTAATGGGCATGCTGATACCTGTCACTTCGACGTTAATGTGTGGGAGGCA
TCAGGGAATCGTAGTGGTGGTGTCTGTGATGACTGTCAGCACAACACAGAAGGACAGTAT
TGCCAGAGGTGCAAGCCAGGCTTCTATCGTGACCTGCGGAGACCCTTCTCAGCTCCAGAT
GCTTGCAAAC
gtaagtaacctgtggtttccagaaaataggctgatttgtacaagagatgaatctctttat
ccctcattctgctaacccaaaagaaggaggtcattgaggttctgagataacacactcaca
gatatcggttaatttcttcattgataagaggcaagaattttcaaccagttgggtgaaaac
EXON 6  214 bp
atctcgcttatctgtcatttaattagctttcattctctgagcatacactcactggctaaa
gaaggagtctcagaaatatgctgtgtggtgaagggaagccacttggggatggtcaagcct
aatgttcacacgggtgatctacagtcagtctttgatccttgcgtgtcctctctgttgtag
CGTGTTCCTGCCATCCAGTAGGATCAGCTGTCCTTCCTGCCAACTCAGTGACCTTCTGCG
ACCCCAGCAATGGTGACTGCCCTTGCAAGCCTGGGGTGGCAGGGCGACGTTGTGACAGGT
GCATGGTGGGATACTGGGGCTTCGGAGACTATGGCTGTCGACCATGTGACTGTGCGGGGA
GCTGTGACCCTATCACCGGAGACTGCATCAGCAG
gtgaatgtgcaaggctcttgctctcagctgcatgtatttcaggctcttttgaaaacctat
agtgatttggaaaatcttgcattctgttaatggagcaaagatgtatttgcacatctcttt
taaagaatttttgtcaggctgggcgtggtggctcacgcctgtaattccaacactttggga
EXON 7  116 bp
agatcatctaattcattttgcaaaataattattgtcttcacaatagttccttaaaacact
atttctggaaaaaggaagaatgggaaggcagaagataaggtttaaatctctatagattca
tttctatacaagttctaaaaaattcctgaatacgttctttatcatgttctattttgttag
CCACACAGACATAGACTGGTATCATGAAGTTCCTGACTTCCGTCCCGTGCACAATAAGAG
CGAACCAGCCTGGGAGTGGGAGGATGCGCAGGGGTTTTCTGCACTTCTACACTCAG
gtgagatggatgtaaccaggcatcatattttcaggtctggtcttatgtaacagtgatacg
tgacaaaccagggtccagcttttggatcctatgaggggaactctttagttctggggtttc
atggtataataaagtagtgactcctgtaagtatgaaactgtaaaatatagctaaggggta
EXON 8  69 bp
tttagaaagagactctacttcttttgaatgactttcgtggttccttggtacttacagatt
acactgtatgcatcactcaaggcttaagggatgtgttatctggatacacttgctgatctc
ttattttttctttctttgcttttctaataactaacaccatttttaatttactttccatag
GTAAATGCGAATGTAAGGAACAGACATTAGGAAATGCCAAGGCATTCTGTGGAATGAAAT
ATTCATATG
gtgagtctgaaatccttgaatgcttctgagaacctattcacactaagttcagagaatttt
taagaaaatgggaggcctgactgatgacattgtgtataaatgaaagcacaaagcattagt
cttacataataacactaaacacagtgttctggtcttgagctagattttcctgatgtagtt
EXON 9  171 bp
ttccttagaataatggcttctaactccatccaagttaatgcctaatgatttttaaagcaa
attttcacatcctcatcatcaattcacctttccattatattctgaaatgcatacttgagt
gttattcaaacttcaaatgataatatgaaattctatgcattttgacttctgtgttaacag
TGCTAAAAATAAAGATTTTATCAGCTCATGATAAAGGTACTCATGTTGAGGTCAATGTGA
AGATTAAAAAGGTCTTAAAATCTACCAAACTGAAGATTTTCCGAGGAAAGCGAACATTAT
ATCCAGAATCATGGACGGACAGAGGATGCACTTGTCCAATCCTCAATCCTG
gtgagtattagactttcctatcttagtacctaccttgtctctgctgatttgctgcttgtc
ttacatcctctgaagcacaacataaacaaactcagcaagaacatctctccctttcaccat
ctgactcctgcggaaaatccaaatggaattctttgaactaacatcgaaaaattatttctc
EXON 10  1416 bp
gattacctaaacccaggagattgaggctgcagtgagccaggattatgccactacactcca
gcctgggtaacagagcaagaccttgtctcaaaataaatgcaaaagaaaacctgctggagt
cacatctctcccttcaacaaagtatgatactgtatagcccctaattttgttcttttttag
GTTTGGAATACCTTGTAGCAGGACATGAGGATATAAGAACAGGCAAACTAATTGTGAATA
TGAAAAGCTTTGTCCAGCACTGGAAACCTTCTCTTGGAAGAAAAGTCATGGATATTTTAA
AAAGAGAGTGCAAGTAGCATTAAGATGGATAGCACATAATGGCACTTGTCTATGTACAAA
ACACAAACTTTAGAGCAAGAAGACCTCAGACAGGAAACTGGAATTTTTTAAAGTGCCAAA
ACATATAGAAATGTTTGAATGCATGGGTCTTATCTAACTTATCTCTTCTGGACCCATGTT
TAAATACAGTTTTATTTCATGAAGAGAAATGAAAACCCCTACACTGATATCTGTTTTCTA
TGGGACTGATTCTGAAATTCTTAACTATTAAGAATATTTTAATAGCAGCATGACATTTAG
CAGTAATCCATTAAGGGCAGTACCTCTAACAAGGACGCCTTCCAGCTTCAGCGATGTTAC
TTACGTTTGATGCTACTTAAAGTAATGAATGACGTTTTAAGGAATCCCTAACCCTACTAT
CAGAAAAGGTGTTTGTTAAAGAGCCTTCTCTTGTGTGTTACGCATGAACTTTGGTCTGTA
GGTGTTAAATGGAACCTCTCCATGTGTATATAGTATTTCCTTGTATAAAGCACTTTACTA
CCTACCACTTGTGTTGTGAACGTTTGGTGACTGCTGTTGAAAGAAGGAAAAGGGTGTGTG
AGAAAGCCTACTGAAGCAGCAGCACTGCCACTACATGTGGACAAAAGTGACCATATAAAA
GAAGTTGTGCTATTTAACTCTGAATACTTGGAGAAACTAGGTGAAGATGCAACCAGAAAG
GAGAATATGTATGCGTGAAGTCTCAGCTTTGAGCTGGAGGCTAGATTCCAAGATGACAGC
CATGATGAAACTTTTTAAAAAACTAAACCAGAAGAGACTTTAAAATAAGAGAAAGAAATC
ATAAATGTAGACATATGCTTGGCTAAAGGGGAAATGGACTTTAAATTTTAAAGAGCTCAT
TTGCAATGCACTTGTATACACTTCAAAAATTATTGTAGACACAGAATTTGTTATATTTTT
GTGCTTAGTATTTAAACCTGAACATTGAAACAGTTTTCCTCCTTGTCTTTCTTAACAGTA
ATAGTCATTATATTTACCTGTTTTTTAACACAATGTATGTGATAGTCAAAAAATCACAGT
TTTTCATTATTATTCATCTTCTGTACCCACGCATAACCACTATACATAGTTTCTTTTGTA
CTTGAATATACAAAACATGAACACAGTGCCATATGAATAATTTCACATACAGAACCTTTT
TTTCTCTGAAGTCCTGTGGACTTGCAAATATATATATATATTGCTTTGTTAATTTGTTTT
TATATTTCATATATGTAATAAAGGAATATGATCTGA
tttttgtctcatttcttaactctttcagtgatgctaaagattatcttctcataatgaggg
aacttaaatctaattcattaatataagaaaataaaagaagacccgactttctgttactcc
ggggttttggaatggagtggaagctaactcagatggatttattttctgtagcctttagac