Gene LIN7A Variant 1
DNA : 140.47 KbNT_019546
mRNA : 1176 bp NM_004664
CDS : 702 bp NP_004655
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  244 bp
atattctgaccattttattagagtggaaagttgaaaggaagcaacccgccagctacaccc
acccagcgctcctgggggtggaatagcaaagttctagggcagagccttccctcccagagc
ccggcgatgcagtcgctctcggatacctgctcagctccgcaccgcaactgaagatctgcc
GCCGCGGAACAGTTGCGTCTCCATCTGGCTACCAACCCACCCAAGCTTTCTTCTCCACCA
CCACCACCTTCCTTCCTTCCCCCTCCTCCCCCTCCTTTCCGTCTTCCCTCTCCACCCCCG
CCCCCAATCTCCTCCTTTTTTTCTCACTACGAGCGGTTGCTGATGCTGAAGCCGAGCGTC
ACTTCGGCTCCCACGGCAGACATGGCGACATTGACAGTGGTCCAGCCGCTCACCCTGGAC
AGAG
gtaagggagcggctcgctcgccaggccaccgcgtcccctctcccctcctcccttccccgc
ctgccaattcccaacgggacatgggacgcgctcaggcaggaggagaaggggaacgaggac
gagccaggaaggcgttcgcgccgagaacagaacactttcttcccctttctctccccgcta
EXON 2  119 bp
aacaaattaaaatgactttttaccaaaagatgagaccaaaaagctatgaatataagttct
gattatgcaatttaagtccacttgcttttcaatgtcatcatccaactggaataatagtac
tttcagctgatgagatacaatttattctaggtttctctattttcattttttttcattcag
ATGTTGCAAGAGCAATTGAATTACTGGAAAAACTACAGGAATCTGGAGAAGTACCAGTGC
ACAAGCTACAATCCCTCAAAAAAGTGCTTCAGAGTGAGTTTTGTACAGCTATTCGAGAG
gtatggcactaaaattttaataactaaattcagccatatgtcttcttcatagaaaacatg
tcttctctacacaaacagttgaaattgttaagattggaactacattttaattttctgttt
ttagctacttggacagatgataaaatataatttagcctgctaaattagatccagccagga
EXON 3  72 bp
atgagtaataatatctgctgtttaaggagtgctatcaggtacattcccaaacatcagacc
tatgttattttgcaatagagaatttttttcctacagtgaaaatataattttctttctgca
ataaaagaattattattcttcatgttcttacacattcttctttttatgtgaacattttag
GTGTATCAATATATGCATGAAACGATAACTGTTAATGGCTGTCCCGAATTCCGTGCGAGG
GCAACAGCAAAG
gtaaggcttgagtaactttaaaaatatacttgaccccagttatctagtaattgattgtgc
gcgtgtgtgtttcaggtattctcgtgtgtacactgtaagagaatttagacatcagtggca
gcccagagtctagaaccagtactacttctcaggtaaaaatcctaatggaaaattgaacgt
EXON 4  210 bp
gaaagaaatcctagatggcatctaaatgaagaaagtcctctgctttttgtgttctttctt
tcacaggagaatactataaaaatatgagaagttgcctgagctacccactgcaaagcatat
gattagcctttatttccctcattttattaccaaaagaccatctttttttttttttttcag
GCAACAGTTGCAGCTTTTGCAGCTAGTGAAGGCCACTCCCACCCTCGAGTAGTTGAACTG
CCAAAGACTGATGAAGGCCTTGGTTTTAATGTGATGGGAGGAAAGGAGCAAAATTCCCCC
ATTTATATCTCTCGCATAATTCCTGGAGGGGTGGCTGAAAGACACGGAGGCCTCAAAAGA
GGAGACCAGCTGCTATCAGTGAACGGAGTG
gtatgtttataaaataaccagagattttctccttaagcacattctttttttttgccccct
gctattactgaagtcaacgttgaaaacctagaataaatattcattttatgtctaaccagc
tttctaagcattgatggatattaaacctataaaagctgcaatctaatttttatgtctcat
EXON 5  219 bp
acctgcttatagtttaaccacaatgtaataaataataacgatgatggtaagataactcat
ttgccatgttttcttaaaattttaaattttgggttcttaatgtgatattaatttcagatt
tgtctccagggaaaagaacattgaacctcctccctttaagaagtgtcattgtattttcag
AGTGTGGAAGGAGAACACCATGAGAAAGCTGTGGAACTACTCAAGGCTGCTAAAGACAGC
GTCAAGCTGGTGGTGCGATACACCCCAAAAGTTCTGGAAGAAATGGAGGCTCGCTTTGAA
AAGCTACGAACAGCCAGGCGTCGGCAGCAGCAGCAATTGCTAATTCAGCAGCAGCAACAG
CAGCAGCAGCAACAAACACAACAAAACCACATGTCATAG
gtgagaagtgacttattctatacaaggagtatatatatatatatacacacacacatatat
gtatatatgaatatacttaaaatatattttagatatgttctaaaatatattttcttagct
gaaacaaaatcattagatttaaataatccaaacaaaatcaatcaaacaaaagacagtgat
EXON 6  312 bp
tacttcctttgcaaacatcaaacgaattttttcatatgtagaagatggtgcatgaatgat
agcacccaaaataatccttgctgttctcacatagcatatgctcttttgatatttttagca
tattgtagttgacaaatgaatactaatcactgatttctcttcactctttttctctttcag
GCCCTTGAGGGAAAGCTACTTGATCAAACATCCGATAGTCACAAATTTGAAACCGTGCTT
CAGAATCCCAGCACATAGTAAAAGACAACACTGATAATTATACCTGTCAAGAAGCTGTGA
ACACATGGTGTATAAATTCTTTACCAAGGCAACTCAACACCTTCTTTCTCTGGGCTTGAA
CCGCCACTGCTCACGTGGGCTTTACATACATTGACCTTCCATTCACTGCAGTGGGAATTC
TCAGTGTGCAGAGGGAGAGGTTTTCTAGTCTGCAAACTGAAACAGTGTAAGAAGAATAAA
GTCTATGACTTT
taaataaatcaccagggccaagattgagtgaatcttgggtccatagcttttccagatatt
agcaaacccctcattaggctataattcaaactgcatcagttcaaagtgaaacctacacat
tgctccttaccctcacctgctccacaatccatagtgctgagttgtctgaattggaattcc