Gene KRT5 Variant 1
DNA : 5.88 KbNT_029419
mRNA : 2301 bp NM_000424
CDS : 1773 bp NP_000415
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  718 bp
tacttgctagcagcgtcaccaacttgctgccaagagatcagtgctgcaaggcaaggttat
ttctaactgagcagagcctgccaggaagaaagcgtttgcaccccacaccactgtgcaggt
gtgaccggtgagctcacagctgccccccaggcatgcccagcccacttaatcattcacagc
TCGACAGCTCTCTCGCCCAGCCCAGTTCTGGAAGGGATAAAAAGGGGGCATCACCGTTCC
TGGGTAACAGAGCCACCTTCTGCGTCCTGCTGAGCTCTGTTCTCTCCAGCACCTCCCAAC
CCACTAGTGCCTGGTTCTCTTGCTCCACCAGGAACAAGCCACCATGTCTCGCCAGTCAAG
TGTGTCCTTCCGGAGCGGGGGCAGTCGTAGCTTCAGCACCGCCTCTGCCATCACCCCGTC
TGTCTCCCGCACCAGCTTCACCTCCGTGTCCCGGTCCGGGGGTGGCGGTGGTGGTGGCTT
CGGCAGGGTCAGCCTTGCGGGTGCTTGTGGAGTGGGTGGCTATGGCAGCCGGAGCCTCTA
CAACCTGGGGGGCTCCAAGAGGATATCCATCAGCACTAGTGGTGGCAGCTTCAGGAACCG
GTTTGGTGCTGGTGCTGGAGGCGGCTATGGCTTTGGAGGTGGTGCCGGTAGTGGATTTGG
TTTCGGCGGTGGAGCTGGTGGTGGCTTTGGGCTCGGTGGCGGAGCTGGCTTTGGAGGTGG
CTTCGGTGGCCCTGGCTTTCCTGTCTGCCCTCCTGGAGGTATCCAAGAGGTCACTGTCAA
CCAGAGTCTCCTGACTCCCCTCAACCTGCAAATCGACCCCAGCATCCAGAGGGTGAGGAC
CGAGGAGCGCGAGCAGATCAAGACCCTCAACAATAAGTTTGCCTCCTTCATCGACAAG
gtgagctacgatcttttgtaaaaaatcactgtgggtctgaaataaatgccaaagagagag
aaagaaggaagatgttttggctttgtgcaaatacttttatagttgtacagttctgtgttt
ccgtttgtttctgtgccctggatttgtggacacgttctgaattagactggcagctgggaa
EXON 2  215 bp
ctccccctggaaaagtgagtttgggtgcctcagtctgcacctcccctcctggggcccagg
gccaggcacagtgcacagaaaagctttagagggacggaaagaggtgggaggcaccttagt
gagttgatcatagaacatgaaatccaagtttctctatcttcaaaccctgctcccctccag
GTGCGGTTCCTGGAGCAGCAGAACAAGGTTCTGGACACCAAGTGGACCCTGCTGCAGGAG
CAGGGCACCAAGACTGTGAGGCAGAACCTGGAGCCGTTGTTCGAGCAGTACATCAACAAC
CTCAGGAGGCAGCTGGACAGCATCGTGGGGGAACGGGGCCGCCTGGACTCAGAGCTGAGA
AACATGCAGGACCTGGTGGAAGACTTCAAGAACAA
gtgagttggggtggagggtggacacaggggagggtggtgtcttcttggtaccagatgggc
tttgttactagtctactaccatgccttcctttggggctgggaggatataccttccatgga
cacctccagtactaaaacaaacaaacaaatacacaagccaggctcatgtttagaaagttc
EXON 3  61 bp
agtatttaaatggggagggaccttggccagaggttcatgctaccagtgtcccctccctct
ctgcctatgaggagaagccccttcccactgcaaaagtaggcttacagttgactgcataat
aaagaccccttacctgttgctcatcctctgacaaacacttcccatccctttcaccaccag
GTATGAGGATGAAATCAACAAGCGTACCACTGCTGAGAATGAGTTTGTGATGCTGAAGAA
G
gtgcgtgtgggtgggagagaaccagcagcctgcagctatgctctctaagcgtggagctca
cttgagtagggtgacggtgtgtgcagtgccaatcatccctgtttccccaggatgtagatg
ctgcctacatgaacaaggtggagctggaggccaaggttgatgcactgatggatgagatta
EXON 4  96 bp
caccaccaggtatgaggatgaaatcaacaagcgtaccactgctgagaatgagtttgtgat
gctgaagaaggtgcgtgtgggtgggagagaaccagcagcctgcagctatgctctctaagc
gtggagctcacttgagtagggtgacggtgtgtgcagtgccaatcatccctgtttccccag
GATGTAGATGCTGCCTACATGAACAAGGTGGAGCTGGAGGCCAAGGTTGATGCACTGATG
GATGAGATTAACTTCATGAAGATGTTCTTTGATGCG
gtaagaaacttatctaaatttttcacatgggtgggttttttttcctcaagttgtcatatc
acaatgagtgaaagatttgaatggaactgacattaaataacacaacacagaaccagatga
ccgactccaaatctccctgcaggagctgtcccagatgcagacgcatgtctctgacacctc
EXON 5  165 bp
tggatgagattaacttcatgaagatgttctttgatgcggtaagaaacttatctaaatttt
tcacatgggtgggttttttttcctcaagttgtcatatcacaatgagtgaaagatttgaat
ggaactgacattaaataacacaacacagaaccagatgaccgactccaaatctccctgcag
GAGCTGTCCCAGATGCAGACGCATGTCTCTGACACCTCAGTGGTCCTCTCCATGGACAAC
AACCGCAACCTGGACCTGGATAGCATCATCGCTGAGGTCAAGGCCCAGTATGAGGAGATT
GCCAACCGCAGCCGGACAGAAGCCGAGTCCTGGTATCAGACCAAG
gtgggtgctctgatgactgtctcctgagtgaggggacacacccatgtctaggattctagg
ccatgacgacactaagaatggggctcctggaacctgctgaagcccattgggatgctttat
aggaatggctgtgtagacaatttccatctaaacccaaggacctgagaaataatctcactc
EXON 6  126 bp
ctctgaatctcacaccagtgtctccaggagagcaaaggcactagactagctcagccttgg
aaaagcctgaaccagccccacactatttgccaccacttagtactcactgcctgtgaactt
tgggaaagttcttcccattctcatataaacagaatctttcctctttcctggctgcatcag
TATGAGGAGCTGCAGCAGACAGCTGGCCGGCATGGCGATGACCTCCGCAACACCAAGCAT
GAGATCTCTGAGATGAACCGGATGATCCAGAGGCTGAGAGCCGAGATTGACAATGTCAAG
AAACAG
gtagggtgagattgaaagagggcaaggaaggggcctgagttctaaaagaaacacctactt
tgttttattttgttttacttttgctaaacacacgcagctagatccagtaccagtgtttca
gtgtcctgccacccacgatgtactggtttctctctgggattcatgatagtttggtttgtc
EXON 7  221 bp
ttgttttacttttgctaaacacacgcagctagatccagtaccagtgtttcagtgtcctgc
cacccacgatgtactggtttctctctgggattcatgatagtttggtttgtctgacccaga
aactcagaaggagacacctcaggtcccaagcaaccccactctcctcctttctatctgtag
TGCGCCAATCTGCAGAACGCCATTGCGGATGCCGAGCAGCGTGGGGAGCTGGCCCTCAAG
GATGCCAGGAACAAGCTGGCCGAGCTGGAGGAGGCCCTGCAGAAGGCCAAGCAGGACATG
GCCCGGCTGCTGCGTGAGTACCAGGAGCTCATGAACACCAAGCTGGCCCTGGACGTGGAG
ATCGCCACTTACCGCAAGCTGCTGGAGGGCGAGGAATGCAG
gtgagtagacagcatgaactcaagatggccttcagctgataaagcgaagctgctctactg
tggggtgtacaacacacatacatgagatcagtgacttgtgcgtgataatgacacatcatc
aacactatttcagtctgactcatggccatatagctgacctcaactcacttttctggtctc
EXON 8  35 bp
ccctcttcattggaaaatccctctggagagttctcccttcctttaacttaagcagctttt
gggtgtacagactcctggcttatggaatgaactcgaatcatgaggatgggagttagccac
atagactaatgctgtctttttgggagctgttaacccttaattcaatttttcccctttcag
ACTCAGTGGAGAAGGAGTTGGACCAGTCAACATCT
gtaagtagctttgaacagacattaacaacgacaataatatgggatatatttagtgccaac
tcagaattctgctgtttctagatccaaacttttcccatcccagcatatggttatttataa
taatacacttagtaagttgtgggtggtggaggggaaggacagattgggacaggaagcaat
EXON 9  664 bp
cctcttacactcacccacttttttagggaccttaattaaatgacagttcttccgggcctt
gtttgctactctgtaaagggggtccagtagagtgctccaacaccagcagatcaaataaat
gggccatgcaggatcagcctggcagatggtctcactgagtcctccctcctttccctgcag
CTGTTGTCACAAGCAGTGTTTCCTCTGGATATGGCAGTGGCAGTGGCTATGGCGGTGGCC
TCGGTGGAGGTCTTGGCGGCGGCCTCGGTGGAGGTCTTGCCGGAGGTAGCAGTGGAAGCT
ACTACTCCAGCAGCAGTGGGGGTGTCGGCCTAGGTGGTGGGCTCAGTGTGGGGGGCTCTG
GCTTCAGTGCAAGCAGTGGCCGAGGGCTGGGGGTGGGCTTTGGCAGTGGCGGGGGTAGCA
GCTCCAGCGTCAAATTTGTCTCCACCACCTCCTCCTCCCGGAAGAGCTTCAAGAGCTAAG
AACCTGCTGCAAGTCACTGCCTTCCAAGTGCAGCAACCCAGCCCATGGAGATTGCCTCTT
CTAGGCAGTTGCTCAAGCCATGTTTTATCCTTTTCTGGAGAGTAGTCTAGACCAAGCCAA
TTGCAGAACCACATTCTTTGGTTCCCAGGAGAGCCCCATTCCCAGCCCCTGGTCTCCCGT
GCCGCAGTTCTATATTCTGCTTCAAATCAGCCTTCAGGTTTCCCACAGCATGGCCCCTGC
TGACACGAGAACCCAAAGTTTTCCCAAATCTAAATCATCAAAACAGAATCCCCACCCCAA
TCCCAAATTTTGTTTTGGTTCTAACTACCTCCAGAATGTGTTCAATAAAATGCTTTTATA
ATAT
aagctggtgtgcagaattgttttttttttctaggtttacaatcagcctagagataccatg
agggtcagtctacccagatgtgattggttcttttgatgattcacagggagaatgggataa
catttaagggaaagtggctattgggggtggcccagagactccaagaagcacagagattat