Gene GPD1 Variant 1
DNA : 5.83 KbNT_029419
mRNA : 1411 bp NM_005276
CDS : 1050 bp NP_005267
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  67 bp
ccattcctgttccacacctgtctgtacccctgtctctcctttccctggctctgccagact
ctctatctccctgggcgccagcctccccacccacccctggagggcggggcttggctgcac
ccacgtgtggtggagttaaatgctcctagccggcagaggagctagggagtgtggcactga
GCCGGCTCAGGCAGAGACGCGGCACCATGGCTAGCAAGAAAGTCTGCATTGTAGGCTCCG
GGAACTG
gtaagcagctctgtcaagtgatatgggggaagggtaggccccccaagacagaggtgggta
ggaggcagaatgggtgggaaaggccctcaggttcctgttcagcccctgctgctatcttct
atcatagcagcacaggacagacggtgcccggccctctcctgacccccgccctcctgggca
EXON 2  178 bp
gagtctcctttctactgccaggtcactggggactatttgtcatgggagtggaggtgataa
ggaaggtaggtaggagtgaacagcctggggggctgctgtgagatcctgaggtggggcgct
gccccaactcctgccactgttccctcctcctgtactttcctgtgctccccctcccaccag
GGGCTCAGCCATCGCCAAGATCGTGGGTGGCAATGCAGCCCAGCTGGCACAGTTTGACCC
ACGGGTGACCATGTGGGTATTTGAGGAAGACATTGGAGGCAAAAAGCTGACTGAGATCAT
CAACACGCAGCATGAGAATGTCAAATACCTGCCAGGGCACAAGTTGCCCCCAAATGTG
gtgagccccaacaccctgcgaagaacagggagaggaagggagggccaggagttggagccg
accttactcaacaggtgcctcctgctgagagggccgcttcaggtgcagcaggacttggga
aggtctcaggagggctgctctgggccctttcctgaggactgaggagaacctatgctttcc
EXON 3  141 bp
gctggggggagggagtagagtgtcttattcctccaagttcagtccttctagattcagtcc
caaacaagccttcctgctcccctaccagcctcactctttggctcccagatctcctgaata
gggttccacaggggctaggggaggtctgccaggcccgcgagcacttggtcacccccacag
GTGGCTGTCCCAGATGTGGTCCAGGCTGCAGAGGATGCTGACATCCTGATCTTTGTGGTG
CCCCATCAGTTCATCGGCAAGATCTGTGACCAGCTCAAGGGCCATCTGAAGGCAAACGCC
ACTGGCATATCTCTTATTAAG
gtgccagggacaccttcatgtggatgggggagggtgcggctcactgttgtggggttcagg
gtgggtgaagcaaggagaacagaaaatggcagacgcaggccaagagtttgctggagaaaa
gagaggcagttggctctggagaggcttaggaaagcagtgaggtgctgggggtcactggaa
EXON 4  139 bp
aggacagttggtcacatgctgtctggcctcctcacagcaaacttgagctgggttggaatg
gggcaggacctgtcgggagggacacagatgagcaatggatttggaagggacagaatttct
gggcggaagcccgcaggtgggcccaaagggcacctggcctgagctccatcctgtgctcag
GGGGTAGACGAGGGCCCCAATGGGCTGAAGCTCATCTCGGAAGTGATTGGGGAGCGCCTC
GGCATCCCCATGAGTGTGCTGATGGGGGCCAACATTGCCAGCGAGGTGGCTGATGAGAAG
TTCTGTGAGACAACCATTG
gtgagagccccctggcacctgcatacacagtgcatctagttgcatcccctccccaaactg
ccccaaccccacttagccatctctttcccataaggcagagaaaggaaaatacaagcatca
gaggtgaaggaggctgggacacccccagggaaggggcttcagggcctgcttagggaaaca
EXON 5  113 bp
cagagttggtgcagtggcacacctgtggtcccagctacttaagaggctgaggtgggagga
tcgcttaagcccaggagtttgagtccagcctgggcaacagagagagactcccatctctat
aaaataaatattttttaaaaagagtccttccctcaaagccttgccccctcctcactttag
GCTGCAAGGACCCGGCCCAGGGACAACTCCTGAAAGAGCTGATGCAGACACCAAACTTCC
GTATCACAGTGGTGCAAGAGGTGGACACAGTAGAGATCTGTGGAGCCTTAAAG
gtgagaggggcacagaggcagctatggggtgaggagaaggccccaaaggaggtctggctg
agctctgcaaggctgcaggtactccaggctctcactattgagcagtggttcccctttcct
accatgtcccatgcatataggaggagctgcagaagcaaggccagggccattcaggccggc
EXON 6  234 bp
cttaagaaagggggtgcagcaaggggggaaaccaagaggcggaagtaggcttctaaaagg
ccacacactatacctctcttctgcagtgggtgtcacggctgatgaaatgagtatgagggg
gctccacatggggcctataggagggggtcttttctcacctatgacctccactccttcaag
AATGTAGTGGCCGTGGGGGCTGGCTTCTGTGATGGCCTGGGCTTTGGCGACAACACCAAG
GCGGCAGTGATCCGGCTGGGACTCATGGAGATGATAGCCTTCGCCAAGCTCTTCTGCAGT
GGCCCTGTGTCCTCTGCCACCTTCTTGGAGAGCTGTGGTGTTGCTGACCTGATCACTACC
TGCTATGGAGGGCGGAACCGGAAAGTGGCTGAGGCCTTTGCGCGTACAGGAAAG
gtgggccccgggagaagggagaacagaggggcggctctgtaggcatccaggtagaggtgc
ttggcgggaggcatctctggagcacaaacattaagactgttgtgcacatccccatccctc
ttttcctcccaagaccccactcccatctgagctccagtctctccaccccctactgacaac
EXON 7  107 bp
catccaggtagaggtgcttggcgggaggcatctctggagcacaaacattaagactgttgt
gcacatccccatccctcttttcctcccaagaccccactcccatctgagctccagtctctc
caccccctactgacaacccttctctcccatttccatccactcatcctgttttctgcacag
TCCATTGAGCAGCTGGAGAAAGAGTTGCTGAATGGGCAGAAACTGCAGGGGCCCGAGACA
GCCCGGGAGCTATACAGCATCCTCCAGCACAAGGGCCTGGTAGACAA
gtaagtattggccacagccccactgattaagggagccacagccagaagtgctcgccctgt
tcatcatcttcctaaacctgccacaaatctgtgaagtggacagaaaggggagtattacct
tacatttcagacagagtccagagcttgcagagtctggcatgcccattgtccgccagctag
EXON 8  432 bp
atctgaccttaaacctagggctagggagttcacattctcagaaggtagaaactcacagcc
atccttcctgagctccaaggtgggagggcaagggacaggagggttaggcagtgagtgggg
gtgggggtagagtggaccaggagtgggaggctaagctgagcctttccctctccaatctag
GTTTCCCTTGTTCATGGCTGTGTACAAGGTGTGCTACGAGGGCCAGCCAGTGGGTGAATT
CATCCACTGCCTGCAGAATCATCCAGAACATATGTGAGTGGGGCCAGGGCCCAGGCCAGG
CCGCTTTTTTACCCCAGTGGAGACCAGCAGAAGCCTGGGGTACCTAGTCACCAGGATCTC
CAGGACTCCCAGGGAGCAGAGTCTTCTCATCTTTTCACTGGAGGACAGGAGGCTATGGGG
CCCAGCTACGCACCTGGAGATCCTGAACTGTCAAGCCACTGGCAGCCTCATGCCACCACA
TTTGCCAGAAATGCAGTTGCCCTGTCCCTCTCCAGATGTGGGGCTTTCTCCATATCCTCT
GGGAGGGGTGGAATCAAGCCCCAGTGCTGCCTGCTTGGTGGCGGGGGTGATGTATGTGGA
GAAGGGTTGGGG
gagaggccggtagggcaggggctgctagtggctgtctcacatacaccagtaatcctgtta
aagggctgaagaagtatcttagccacaggagcgatgaggcaaggattgtcagggaggggt
ctgggcttctgagctgatgcaggccccaaggacccctttgctgacctctgccaggaccca