Gene FBXW8 Variant 1
DNA : 120.19 KbNT_009775
mRNA : 4855 bp NM_153348
CDS : 1797 bp NP_699179
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  400 bp
tagcaaaagtgataggcagcagagctgacgggctgaggggcagctgcgtaaacctctgct
ttgggcgccacaagccacaagccggaccaccacgtgcgtacaggggcagcgccgggggcg
tggcgggggcgtggacgcccacccggaaccctagagcggcggcggcagcggcttccggcc
GCGGCGGACACTTCCCTGGGCGGGACTGTCTCGTGGCACCCGGTGGAACCGAGGAGAACG
TGGAGCGCCGGGAGCGGCGAATATGGACGACTACAGCCTGGATGAGTTCCGTCGGCGCTG
GCAGGAGGAGCTGGCGCAGGCCCAGGCGCCGAAGAAGCGGCGACGGCCCGAGGCTGCCGA
GAGGCGGGCTCGGCGGCCGGAGGTGGGCTCCGGGCGCGGCGAACAGGCCTCGGGGGACCC
GGCGCTGGCCCAGCGTCTCCTGGAGGGCGCGGGGAGGCCCCCGGCGGCGCGGGCGACTCG
GGCCGAGGGGCAGGACGTAGCGAGCCGCTCACGTTCTCCTCTGGCCCGCGAGGGCGCCGG
GGGCGGGGAGCAGCTGGTGGACCAGCTCATCCGCGACCTG
gtgagtggccgtcgcctcccccccgcccatgcctgcgccggcccccgcccccaggacaaa
cccctgcagtgatttggagagtaactgtgtgccactagttgcccgagaaaatgagtagac
gcacaaacaccaatgtttgtgcttgcataggggtctttctggaagcagcacttcccaacc
EXON 2  105 bp
agattctgaaatagttccatgactgcctggtgaaacagtatggatgcctccctcctggga
aacagcctcatctatcttgttaccacctaagaatatctctggtcatttaaagggcctgta
aatttgagttattttcatatctaaaaattataaacttctttcttttttttttcccctcag
AATGAAATGAATGATGTGCCTTTCTTTGATATCCAACTGCCTTACGAATTGGCAATCAAT
ATATTTCAGTATCTGGACAGGAAAGAACTAGGAAGATGTGCACAG
gtaaggtgtcaccaacagatgttccagattttcctaaatgtgtgattaaggtataggact
ctccggggtaatagaaatttactcacagaattataaactttgcagaattaatgaattgga
tggcaagtttacttgaaggaaagccaccttgaccttagaggattatgttccacatcacta
EXON 3  165 bp
gaaagataaaactggaaacatttgcttgtatttttttttccacctcatagtgttttgtta
atgagacattttatactgccataaacccagggcaataatataggtgttgattgatttttg
gatgacaaggggcttctctaattgcagaatttgacatttgtgtcacttctgctgttttag
GTGAGCAAGACGTGGAAGGTGATTGCAGAGGATGAGGTGCTGTGGTACAGGCTGTGCCAG
CAGGAAGGGCACCTTCCGGATAGCAGCATCTCTGACTATTCTTGCTGGAAGCTCATCTTC
CAAGAGTGCCGAGCCAAGGAACACATGTTACGAACCAACTGGAAG
gtgggcagtggccaatatcattacctgtgaaagaatagcctgcaaggacatgggaatcca
agctttcactcatagcctgagattaattgccaacagcgaagggagaggggtacactgagc
ctccccttcagctgttggtgacttgttgcccattttgttcaccattagatgatctgcctc
EXON 4  89 bp
gcttaacagcttagcatgttagtcatcatctttgtctttttgaatgcccatggaactttg
aatgcacttgttgtccatgctgtagagaattgctgtggaaagtaggtgaaaaagcacgat
gcttggctttcgggctgtcccgagagcagtctaaactgcatcccccttttcctcacgcag
AATCGCAAAGGTGCCGTGAGCGAGCTGGAGCATGTTCCTGACACAGTTTTGTGTGATGTG
CATTCTCACGATGGTGTGGTCATTGCGGG
gtaagccaaaccgtttccactgagtgctctgcatctgaaggtctttcatttttctcatac
caccctctgagtaccagtgaccttagcttcctttgagagcatgtacctccctcagttaca
gcccatgtggaagagggagagtctccgtgattctgttcccaaggacgtgagagcgcgcag
EXON 5  158 bp
ccttctgtcatctagttgacattttctcctgttggagtcactcatctaaacagtgcctca
gcagtggctctacaccacccgattcttacttgtctgttgttgtaaggctctgtgcatttt
ccccaccatagccctgctcttcaatctccttttggaaccaagtgtgtcgttctcttccag
ATATACATCAGGGGATGTGAGAGTGTGGGACACCCGCACCTGGGACTACGTAGCCCCCTT
CCTGGAATCAGAGGACGAGGAGGATGAGCCTGGAATGCAGCCAAATGTCTCCTTTGTGAG
GATAAACAGCTCGTTGGCAGTAGCAGCTTATGAGGATG
gtaagtaaccacaaccctcctccctattaaggaaaaaaaaaagctttacaaaaattaagc
agctgtggccggctcccccctgtaatccctccatatgtacacgtgggcacacacacatgt
tcacacacatacactcactcttgcttttatttgaagaagttggccaacaaccgtcaatgc
EXON 6  197 bp
ttaccttcaggccatgtgcatcaggtatatatgaaacgtaagtgatttcgtgtttagact
tgggtctcatttccaaggtatctccgttaaaaaattttcctttgtgttgcatgtttttaa
aataattgaacatattaagtaaatttaaaattgttacctgcattgtttcttgctgcatag
GGTTTCTTAATATTTGGGATTTAAGGACCGGAAAGTACCCTGTTCATCGTTTTGAGCACG
ATGCAAGAATACAGGCACTAGCCCTCAGCCAGGACGATGCAACCGTGGCCACAGCTTCTG
CTTTTGATGTCGTGATGTTATCCCCCAATGAGGAGGGGTACTGGCAGATAGCTGCGGAAT
TTGAAGTTCCGAAACTG
gtgagctttttagtctggtcatcttattttctattcttagaatctctgggtctaatgtaa
gcacgtactaatggtgttggtaactcccattcactcagagcttcctgcgggccttacctc
cataagtctaactacagccttacaaaataggtagtagcattttccccatttaccaagaag
EXON 7  207 bp
atactgagcatcttttctgttgtgtaagagctgtttgtgtttcatttcctgtgagtgttt
catttgcccatctttttctgttgggttgctggtcttctcattgatgtgtaggtggaattg
catatttttgatcaagtcaggatgaatttatgggactaaacaactcttaccttttaacag
GTTCAGTACCTTGAAATAGTTCCAGAAACCAGAAGGTACCCTGTGGCAGTAGCCGCTGCT
GGAGATCTGATGTACCTGCTCAAAGCCGAAGACTCCGCCAGAACCCTCCTTTACGCCCAC
GGCCCGCCTGTCACATGTCTAGACGTCTCGGCCAACCAAGTTGCTTTTGGTGTACAGGGT
CTGGGATGGGTGTACGAAGGAAGCAAG
gtacacaactagcaagatatataattaacaaaaaagaatatagatttattttttagaagg
gaattgaaaaattaaagctcttcaatatttttccagatatatcaggccagtatataagca
tggtcaaaaaattcaagaacttcaaaaggattgcaaatgaaaagtaatcattttctttct
EXON 8  128 bp
cttaatagccatgtccctatactatcagtaacctgaaaaagatcaggaaattaagtggca
gaacatcttcacgggagctcagtgataaggatcatgccctccacgatggtgaaatgaaag
tatttgatgtcggcctggtgtgtggaattgtgggcccacacatttctcttcctctctcag
ATCCTGGTGTATAGCCTGGAAGCAGGACGCCGCCTCTTGAAGCTGGGTAACGTTCTCCGT
GACTTCACGTGTGTCAACCTCAGCGACAGCCCTCCCAACCTCATGGTCAGTGGCAACATG
GACGGGAG
gtacgtgagttggaagggcattgccttgcagccccatggcttctgccaaggcccggcccc
cactgcgctgctcacactgcccggttctcactcaacagctctgcccacctgagttcagcc
ccgatcccataaacactctagactcagagaacaaagtcctgtattaggtaatagttggat
EXON 9  174 bp
accgtgtgggtcctccctgacagtctgtgcttgatgtccttattatcgatgtttgtttgc
agctgaggagtttttcatagcagtgttgtgcatagaccagcaccgtggagggggagtttg
tcatttgaagctttgactctaaccccatttcccttctctgctcttcctgggcctgtccag
GGTGAGGATCCACGACCTCCGCAGTGGTAACATCGCCCTGTCGCTCTCCGCCCATCAGCT
CAGGGTCTCTGCTGTGCAGATGGATGACTGGAAGATCGTCAGTGGAGGCGAGGAAGGCCT
GGTGTCCGTGTGGGATTATCGGATGAACCAGAAGCTGTGGGAGGTGTATTCCGG
gtaaggtgcattctagacactcttgggagttcctagtaggaacagggaaggcagcactaa
tcagcctgcaccaggcacggtgctaaatgccccctaccccccggcttcgccaggtgaatc
cttactgtgaccctaggagccagctgctgtcccagcaccgctctgcagaggaggaaacag
EXON 10  111 bp
acctgagcttcgggaactgaggtgagacactgcttccatgggggccctgttccctctgtg
aaagagaagcttagctttatgggttctagaatcccctgcagctctgaactcccaggcctg
cggcagcaagtgcaggcccagtggacgcccccttacgagctctctcccactgccttccag
GCACCCGGTGCAGCACATCTCATTCAGCAGCCACAGCCTCATCACGGCCAACGTGCCTTA
CCAGACGGTAATGCGAAACGCCGACCTGGACAGCTTCACTACTCACAGGAG
gttagtggtggggccgggcgagtaagagaccatcttagtttgactgatgtatagaacccc
accccccccgccgtgacacattgcaccctatgggctataccctcaggcagggccctgcct
ttctgcgaattggaaacataaacgtggatgctgacctgtactgagcacccagcatctgat
EXON 11  3121 bp
ccccacgttgaccgctaagccggggactgtgagtatctgacgctgtgtgcccagagaacg
cgtttgtgaagctgaacctctatctggtctcaggcgaacgcctcctgcacagacagaagc
ggctggggtgagggccagcgaggcagccctgacctgtcaccatctttgtgctctttctag
ACACCGGGGGCTGATCCGCGCCTATGAGTTTGCGGTGGACCAGCTGGCCTTCCAGAGCCC
TCTCCCTGTCTGCCGTTCATCCTGTGACGCCATGGCCACTCACTACTACGACCTCGCACT
GGCCTTTCCCTATAACCATGTTTAGGGATGTGCCTCAGTTGGGAGCAAGGAGAAAAATGG
GAAGAACCAGTTTTATCCATCTTAAAACGCCAGGCACCTCTTCACAGGTGGTAAACATTT
AGGGGAAGAAAGCAGCCCAGGGTGCCATGCCTGACAGCACGCATCTCCCTGACCCCTGCA
CTTCCCCCAGCGCCTGGGGCAAGCTGGCGTGTGCCAGGGCTCGAGTCCCACGTGCTGCCA
ACTCAAACATAGCCTCCTTCCCCACCCAGCTGGCCACCCTGGCCTCAGCTCCCTCAGGAC
GCCTCAGGGATCTCGCTGCGCGGTCCTATACGGTCCCTGCTTAGCCAGCTTCTGTGTGTC
CGCCCTCCCAGCTCCAGCCCTGCAGGCCGTCTTTTCCGTCTCCAGCCCCTTACCTCTTTT
CCTCCGAGGGCCTTTGGATGTGCTTGTTCCTGGCCTCCAAGGCAATAACCTCCATGTCCT
TTTCCCTGTATTTACTTGGGGTGCTCTTCTGTGACACTTGCCACCACCACCTTCCAGTAG
CAAGCTGGTAGAGCTGTACTTTTTCTTCACAGCTTTTACCATGGTTTATAATTATATACT
TATACAGTTTAGTCATCAATGACTATTTTGCTTACTATTGTGTCTATGATATGTGATACA
AAGCAAATATTTTCTAAATATTCATTGACTAAACAGCCATCAAGATGAAACAGGACAGGA
GAGAACTGTTCAGTGTGATACAGAGCTGCCATTTCCAAAGTATTCTGGAAGCAAGCCATT
GCCTTACTCTTGATTTTCAACAGTTCTAAACAGCAACAGCATCCACCTAATATACCTTCA
GAATATCAAAGCGAAAACTGATAGAACTACAAAGAGAAATAAAATCCATTCTCACGGCAG
GCAAATCAGTGAGAAAAATGTAAAGATCTGGAGGATTTACTTAGTATCGCTAACAAGCTG
GATCCAGTAGATGCGTATGGAATTTCAAATACACATAGACGATGCACAAAAAACCACCCT
GTACGAAGGCCACAAAGAACAGCTCAGATGCACAAAGATTCACACCATACAGGCCAAATT
ATAGAATCCCCCAACCCCAAGACACTGCACCCTATGGGCTATACCCTCAGGCAGGGCCCT
GCTTTTCTAGGAATTGACTCCAATGCAGAATAGTGAGAAATCAACAAAAAGCAAAATAAG
ACAATTCCAGACACTCCTGAATTTACTTGGATTTAAAGAGGTTAATAAAAACAAACTATA
AACTCTCTAGACTGGGCTGACAGTAAAAGCACAGAATACAAAACCCAGGGGATGGGGCTG
GGAGGGGCTGTGAGGGGCTGGCACCTCAGCTCAGAAAAGGTAGCAGCAATCCCAAAGCAG
CAGAAGGCAGGGGTTAAATCAGGATAAAAACAGACATCAGTGGAATCGAAAACCAATAGT
TAGTTAATATAAAGCCAGAAGGTTTTGTTTTTTTTCAGGTGGGGTCTCGCTCTGTCACCT
AGACTAGACTGGAGTGCAATGGCCTGATCTCGGCTCACTGCAACCTCTGCCTCCCGAGTT
CAAGCAATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGATTACAGGCGTCCGCTACCACA
ACTGGCTAATTTTTACATTTTTAGTAGAGACGGGGGATATTGCTATGTTGGCCAGGCTGG
TCTCAAACTTCTGACCTCAAATGATTGCCTGCCTCAGCCTCCCAAAGTGCTGGGATTACA
GGTGTAAGTCACTGTACCCAGCCCAAAAGCAGTTTAAAAAAAAAAAAGACAAAATATACA
ACTCTTGATAAAACATAAAGGTACAGTGGTCTATGAGGAAGAGAAAAGGTACCTGAGGAT
GCAGAAGTACCTACCACATGGGAACCGTTTGTCCACACTCATTCCAGAGAAAACCGAGTC
CTCTCAGTTGCACACGTGTACGTATCAGTGGGAAGTGCTTGCCATTACTCCAAAGCCTAG
AACCTTCACGTCATGAAGGTTCTGGAAGGTTTTTCAGATTGCTTAAGATACGCAGCCATT
CCATATTCATCTCCAACTACACAGGGGAACGGAGCAGATAGAGCTGCGACTGGGAAGCGT
CACCTTCCCGTCCAGAGCGCTTTCTTTCAGACCCTGCCTACCTGCAGGCAGATGGACCGG
AGGGTTTTCTGCTTCCTTTCAACCAGATAACTTCCTAAGTGGAGATGGCCTGTAGGTAGC
AAATGCAGGATTTTGTTTACTTTCATCATGTCATGTGGTGGTCAGACTGCTCGCTGGTGG
CCTCGCTTTAGAAGGTTTTCATCAAGCCCCGCCCTTTCTCTCTCATAGTCTTAATGCGTC
TGGACCACTGGGGAAAATATTTTTCTTTTCAAAAAGCAGCCCCTTCAGTCTGCGTTCCCA
GTTCATTTTGCAGGCGCATTCGCCCTTCCTAGTTTGCAGCAATTAAAGATAACGGAGTGT
AAAGTCATTAGACCCAGAATTAGAGCAGCCAGCAGCTGGCCCAGTGTAAAAATGTCCCAA
GTGTAGCCCCTCCCACCGCAGAGCCTGTTTCTAACGTACCTGCCATTCGTGGAAGTCGCC
TGGGTTTTGTAAAGGAGAATTTTTTGGACTCAAGCTGTCATCTTCAAGCACGCCAACTTC
AGGCAGTGTTTTCTACTGCAAACCTCCACATCCTGGAATCAATCACACTGACAGGGAAAG
GATAAATGCTCCTTTATAAGCCAACATGTATCCAAATTAAGCCCCCTTACCTTTATCCAG
ACCCTTTCACAAACAAGTTCTGAGTTTTTAGCCAATTGATCCTCTACTTTCCTTCTTTAG
TCCCTCTCAGGGACGCCTCCATCCCCGGCTCCCCTAAAGGTAGAAGATACTCGAGCATGC
TGCCAGGGGAGCTGGATGGTGAAACACCTGAAGATCTCATATCGCCTCTCAAAACACTGT
CGGACTTGCTTTCTGCTTTATGATGTCCGTAGTTGTTCTAATATTAAATGCTTTGAATTT
C
tttattggtcaagttattttaacttgggcaaggcatacagtgataatcccctggcatgcc
acgattccagctcttcccacccccttgaaatcttacctcccaccgtggtggttttgtaaa
cccacagtcaattggatttgcccagaacctcccctacaggcgctcccagcccaggatcca