Gene DYRK2 Variant 2
DNA : 11.39 KbNT_029419
mRNA : 3467 bp NM_003583
CDS : 1587 bp NP_003574
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  209 bp
cagcgcttccagctccccgcgcccctatgtgagggagacggggaggcccgcggcgcgcag
gggagggcgaggcatgtgcacgggccggagggtgctgcagccgcccgaggaagaggagga
cggcggcgaggaggagagcggggggctcgcggcggcgggccccggccgaggggatgcagt
GGACTGTGTGTGTCTGGCTGTAGCAGACGCGAGGCGGCGACGAGGCGCCGGGGACCCGCG
CGAGGGGCGGCCGGGAGGCGGCGGCGGCGGCCGCCAGAAGTAGCAGCAGGACCGGCGGCG
GCGACGGCAGCCCTGAAATGCATTTTCCTCTCCAGCGGCCATGTTAACCAGGAAACCTTC
GGCCGCCGCTCCCGCCGCCTACCCGACCG
gtaaggaggccgtgccgccgcgccgcatccccggacccccgccggccctgggcagcccct
gtggcgcgggcggccgctgcctgcgggacctcgaacaaagtcggcggcgcggcgcggggg
agcccccgggcggacgacgcgccccgggctccatgcagggttgtgcgcggccccgaaggc
EXON 2  3258 bp
tgttaggcatggcatttatgaggtccatttttcaggatcacatgttttgtggcttttact
caaaccaaatgggattttgtaaatgtgaggttgggggcggtggtgttgttgggggttact
tatacaccatttgaacagacaccacttcttttctatttatatttcctgtctgaattccag
ATTGGCGGCAGTAAGCACACAATGAATGATCACCTGCATGTCGGCAGCCACGCTCACGGA
CAGATCCAGGTTCAACAGTTGTTTGAGGATAACAGTAACAAGCGGACAGTGCTCACGACA
CAACCAAATGGGCTTACAACAGTGGGCAAAACGGGCTTGCCAGTGGTGCCAGAGCGGCAG
CTGGACAGCATTCATAGACGGCAGGGGAGCTCCACCTCTCTAAAGTCCATGGAAGGCATG
GGGAAGGTGAAAGCCACCCCCATGACACCTGAACAAGCAATGAAGCAATACATGCAAAAA
CTCACAGCCTTCGAACACCATGAGATTTTCAGCTACCCTGAAATATATTTCTTGGGTCTA
AATGCTAAGAAGCGCCAGGGCATGACAGGTGGGCCCAACAATGGTGGCTATGATGATGAC
CAGGGATCATATGTGCAGGTGCCCCACGATCACGTGGCTTACAGGTATGAGGTCCTCAAG
GTCATTGGGAAGGGGAGCTTTGGGCAGGTGGTCAAGGCCTACGATCACAAAGTCCACCAG
CACGTGGCCCTAAAGATGGTGCGGAATGAGAAGCGCTTCCACCGGCAAGCAGCGGAGGAG
ATCCGAATCCTGGAACACCTGCGGAAGCAGGACAAGGATAACACAATGAATGTCATCCAT
ATGCTGGAGAATTTCACCTTCCGCAACCACATCTGCATGACGTTTGAGCTGCTGAGCATG
AACCTCTATGAGCTCATCAAGAAGAATAAATTCCAGGGCTTCAGTCTGCCTTTGGTTCGC
AAGTTTGCCCACTCGATTCTGCAGTGCTTGGATGCTTTGCACAAAAACAGAATAATTCAC
TGTGACCTTAAGCCCGAGAACATTTTGTTAAAGCAGCAGGGTAGAAGCGGTATTAAAGTA
ATTGATTTTGGCTCCAGTTGTTACGAGCATCAGCGTGTCTACACGTACATCCAGTCGCGT
TTTTACCGGGCTCCAGAAGTGATCCTTGGGGCCAGGTATGGCATGCCCATTGATATGTGG
AGCCTGGGCTGCATTTTAGCAGAGCTCCTGACGGGTTACCCCCTCTTGCCTGGGGAAGAT
GAAGGGGACCAGCTGGCCTGTATGATTGAACTGTTGGGCATGCCCTCACAGAAACTGCTG
GATGCATCCAAACGAGCCAAAAATTTTGTGAGCTCCAAGGGTTATCCCCGTTACTGCACT
GTCACGACTCTCTCAGATGGCTCTGTGGTCCTAAACGGAGGCCGTTCCCGGAGGGGGAAA
CTGAGGGGCCCACCGGAGAGCAGAGAGTGGGGGAACGCGCTGAAGGGGTGTGATGATCCC
CTTTTCCTTGACTTCTTAAAACAGTGTTTAGAGTGGGATCCTGCAGTGCGCATGACCCCA
GGCCAGGCTTTGCGGCACCCCTGGCTGAGGAGGCGGTTGCCAAAGCCTCCCACCGGGGAG
AAAACGTCAGTGAAAAGGATAACTGAGAGCACCGGTGCTATCACATCTATATCCAAGTTA
CCTCCACCTTCTAGCTCAGCTTCCAAACTGAGGACTAATTTGGCGCAGATGACAGATGCC
AATGGGAATATTCAGCAGAGGACAGTGTTGCCAAAACTTGTTAGCTGAGCTCACGTCCCC
TGATGCTGGTAACCTGAAAGATACGACATTGCTGAGCCTTACTGGGTTGAAAAGGAGTAG
CTCAGACCTGTTTTTATTTGCTCAATAACTCTACTCATTTGTATCTTTTCAGCACTTAAT
TTTAATGTAAGAAAGTTGTTCATTTTGTTTTTATAAAATACATGAGGACAATGCTTTAAG
TTTTTATACTTTCAGAAACTTTTTGTGTTCTAAAAGTACAATGAGCCTTACTGTATTTAG
TGTGGCAGAATAATAACATCAGTGGCAGGCCACTGATTACTTCATGACTGCCACGCATTT
ACAGATTGGTGTCAAAGACATTCACTATGTTTTTATGGTTCATGTTATATCCTCCCCAGG
GTGACAGCCCCTTAAGGCCCTCCTTTTCCCTCCATGCTCCAGGTCCATGCACAGGTGTAG
CATGTCCTGCTTCCGTTTTTCATAAATTAATCTGGGTGTTGGGGGTAGTGGGAGGAGAAC
GGTCAGAATCAAAGTGACATTCTAAGAAAAACTGTACCTTAGAGATTTTCCTCTAGTGCT
CAAACAAATACAAAATAAGATCCCCAAGGTTTAAACTGCCCAGTTAGCATTCTGACATTC
TAAAAGCCGGCAAAGCAGCTTTTAGTGGATAAATGGGAATGGAAACGTGTGTGTTCCTCC
AAATTTTCTAGTATGATCGGTGAGCTGTTTTGTAAAGAAGCCTCATATTACAGAGTTGCT
TTTGCACCTAAATTTAGAATTGTATTCCATGAACTGTTCCTCCCTTTTCTCTGCTTTTCT
CCTCTCTGTTCCTCTTTTAATACCACACGTCTGTTGCTTGCATTTAGTTTGTCTTCTTCC
TTCAGCTGTGTATCCCAGACTGTTAATACAGAAAAGAGACATTTCAGCTGTGATTATGAC
CATTGTTTCATATTCCAATTAAAAAAAGAACAGCAGCCTAGCTACTTAAGGTGGGGATTT
CCATAGTTCCAAAGAAGATTTAGCAGATTAGAGTGAGTTCACACTTTTCAGGTGCCACTG
TAAGGTTCTCTCAGCCTGGGAAACTATCAACTCTTTCTTTAAAAAGAAAGAGGGTTGAAA
ATCCTCTGGACGAACAGAAGTCACTTTGGCTGTTCAGTAAGGCCAATGTTAACAACACGT
TTAGAGGAGGAAAAGTTCAACCTCAAGTTAAATGGTTTGACTTATTCTTCGTATCATTAG
AAGAACCCCAGAGATAGCATTCCTCTATTTTATTTTACTTTCTTTTGGATTGCACTGATT
GTTTTTGTGGGAATGACACTTTATCTGGCAAAGTAACTGAGAGTTTGGTAAAAGAATATT
TTCTTCTCTGAATAATAATTATTTTCACAGTGAAAATTTCAGTATTTTATCACTAATGTA
TGAGCAATGATCTATATCAATTTCAAGGCACGTGAAAAAAATTTTTTAGTATGTGCAATT
TAATATAGAAAGATTTCTGCCTGTTTGGACAATAGGTTTTGGGTAGTACAGATTAGGATA
AGTAAGCTTATATATGCACAGAGATTATTGTATTACCTGTAAATTGATTTACAAGTACTT
AAAAGCGTGGTCCCCAGTGAGGCCAAGAAAGTTTCCGGTTAAGTTCTTTAATAATAATCC
TACAGTTTATCTTAAGAA
aaaaaaaaaggtttgaaaaaaacactttaatttaggcttcgttggttgatggtggaaaaa
aatgctcaggaaatatttcagatatttgccaaaaaaccagtaataaggttaccttattaa
aatagtgatatttgctttactatttaaggtgtcactgataaattaatttgtacttctgtg