Gene DYRK2 Variant 1
DNA : 11.39 KbNT_029419
mRNA : 3616 bp NM_006482
CDS : 1806 bp NP_006473
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  209 bp
cagcgcttccagctccccgcgcccctatgtgagggagacggggaggcccgcggcgcgcag
gggagggcgaggcatgtgcacgggccggagggtgctgcagccgcccgaggaagaggagga
cggcggcgaggaggagagcggggggctcgcggcggcgggccccggccgaggggatgcagt
GGACTGTGTGTGTCTGGCTGTAGCAGACGCGAGGCGGCGACGAGGCGCCGGGGACCCGCG
CGAGGGGCGGCCGGGAGGCGGCGGCGGCGGCCGCCAGAAGTAGCAGCAGGACCGGCGGCG
GCGACGGCAGCCCTGAAATGCATTTTCCTCTCCAGCGGCCATGTTAACCAGGAAACCTTC
GGCCGCCGCTCCCGCCGCCTACCCGACCG
gtaaggaggccgtgccgccgcgccgcatccccggacccccgccggccctgggcagcccct
gtggcgcgggcggccgctgcctgcgggacctcgaacaaagtcggcggcgcggcgcggggg
agcccccgggcggacgacgcgccccgggctccatgcagggttgtgcgcggccccgaaggc
EXON 2  149 bp
gccccgcccgtgggtgtgcgctggggagccgtgacccgaacgcccgtttttactgccccg
gtctcttcctccgtctttctttggaagagggttgtcgctgcccagcggggttggaggggg
ggtctgggtgactttctcccccctgaccctcttttgtctcctcccgcacgtggcttccag
GCCGAGGTGGGGACAGCGCCGTTCGTCAGCTTCAGGCTTCCCCGGGGCTCGGTGCAGGGG
CCACCCGGAGCGGAGTGGGGACTGGCCCGCCCTCCCCCATCGCCCTGCCGCCTCTCCGGG
CCAGCAACGCTGCCGCCGCAGCCCACACG
gtgagacccagcccgcgggcggcccgggcggtgggggcgggaggggccccaggccgaagc
acccggacttggaggggtctgacgccgggagaagaggggtcgagatacaagcagccccac
gcctcgggccgatggtctctcgtcgacgccgccctggttaagttgggcgagcccaaagct
EXON 3  3258 bp
tgttaggcatggcatttatgaggtccatttttcaggatcacatgttttgtggcttttact
caaaccaaatgggattttgtaaatgtgaggttgggggcggtggtgttgttgggggttact
tatacaccatttgaacagacaccacttcttttctatttatatttcctgtctgaattccag
ATTGGCGGCAGTAAGCACACAATGAATGATCACCTGCATGTCGGCAGCCACGCTCACGGA
CAGATCCAGGTTCAACAGTTGTTTGAGGATAACAGTAACAAGCGGACAGTGCTCACGACA
CAACCAAATGGGCTTACAACAGTGGGCAAAACGGGCTTGCCAGTGGTGCCAGAGCGGCAG
CTGGACAGCATTCATAGACGGCAGGGGAGCTCCACCTCTCTAAAGTCCATGGAAGGCATG
GGGAAGGTGAAAGCCACCCCCATGACACCTGAACAAGCAATGAAGCAATACATGCAAAAA
CTCACAGCCTTCGAACACCATGAGATTTTCAGCTACCCTGAAATATATTTCTTGGGTCTA
AATGCTAAGAAGCGCCAGGGCATGACAGGTGGGCCCAACAATGGTGGCTATGATGATGAC
CAGGGATCATATGTGCAGGTGCCCCACGATCACGTGGCTTACAGGTATGAGGTCCTCAAG
GTCATTGGGAAGGGGAGCTTTGGGCAGGTGGTCAAGGCCTACGATCACAAAGTCCACCAG
CACGTGGCCCTAAAGATGGTGCGGAATGAGAAGCGCTTCCACCGGCAAGCAGCGGAGGAG
ATCCGAATCCTGGAACACCTGCGGAAGCAGGACAAGGATAACACAATGAATGTCATCCAT
ATGCTGGAGAATTTCACCTTCCGCAACCACATCTGCATGACGTTTGAGCTGCTGAGCATG
AACCTCTATGAGCTCATCAAGAAGAATAAATTCCAGGGCTTCAGTCTGCCTTTGGTTCGC
AAGTTTGCCCACTCGATTCTGCAGTGCTTGGATGCTTTGCACAAAAACAGAATAATTCAC
TGTGACCTTAAGCCCGAGAACATTTTGTTAAAGCAGCAGGGTAGAAGCGGTATTAAAGTA
ATTGATTTTGGCTCCAGTTGTTACGAGCATCAGCGTGTCTACACGTACATCCAGTCGCGT
TTTTACCGGGCTCCAGAAGTGATCCTTGGGGCCAGGTATGGCATGCCCATTGATATGTGG
AGCCTGGGCTGCATTTTAGCAGAGCTCCTGACGGGTTACCCCCTCTTGCCTGGGGAAGAT
GAAGGGGACCAGCTGGCCTGTATGATTGAACTGTTGGGCATGCCCTCACAGAAACTGCTG
GATGCATCCAAACGAGCCAAAAATTTTGTGAGCTCCAAGGGTTATCCCCGTTACTGCACT
GTCACGACTCTCTCAGATGGCTCTGTGGTCCTAAACGGAGGCCGTTCCCGGAGGGGGAAA
CTGAGGGGCCCACCGGAGAGCAGAGAGTGGGGGAACGCGCTGAAGGGGTGTGATGATCCC
CTTTTCCTTGACTTCTTAAAACAGTGTTTAGAGTGGGATCCTGCAGTGCGCATGACCCCA
GGCCAGGCTTTGCGGCACCCCTGGCTGAGGAGGCGGTTGCCAAAGCCTCCCACCGGGGAG
AAAACGTCAGTGAAAAGGATAACTGAGAGCACCGGTGCTATCACATCTATATCCAAGTTA
CCTCCACCTTCTAGCTCAGCTTCCAAACTGAGGACTAATTTGGCGCAGATGACAGATGCC
AATGGGAATATTCAGCAGAGGACAGTGTTGCCAAAACTTGTTAGCTGAGCTCACGTCCCC
TGATGCTGGTAACCTGAAAGATACGACATTGCTGAGCCTTACTGGGTTGAAAAGGAGTAG
CTCAGACCTGTTTTTATTTGCTCAATAACTCTACTCATTTGTATCTTTTCAGCACTTAAT
TTTAATGTAAGAAAGTTGTTCATTTTGTTTTTATAAAATACATGAGGACAATGCTTTAAG
TTTTTATACTTTCAGAAACTTTTTGTGTTCTAAAAGTACAATGAGCCTTACTGTATTTAG
TGTGGCAGAATAATAACATCAGTGGCAGGCCACTGATTACTTCATGACTGCCACGCATTT
ACAGATTGGTGTCAAAGACATTCACTATGTTTTTATGGTTCATGTTATATCCTCCCCAGG
GTGACAGCCCCTTAAGGCCCTCCTTTTCCCTCCATGCTCCAGGTCCATGCACAGGTGTAG
CATGTCCTGCTTCCGTTTTTCATAAATTAATCTGGGTGTTGGGGGTAGTGGGAGGAGAAC
GGTCAGAATCAAAGTGACATTCTAAGAAAAACTGTACCTTAGAGATTTTCCTCTAGTGCT
CAAACAAATACAAAATAAGATCCCCAAGGTTTAAACTGCCCAGTTAGCATTCTGACATTC
TAAAAGCCGGCAAAGCAGCTTTTAGTGGATAAATGGGAATGGAAACGTGTGTGTTCCTCC
AAATTTTCTAGTATGATCGGTGAGCTGTTTTGTAAAGAAGCCTCATATTACAGAGTTGCT
TTTGCACCTAAATTTAGAATTGTATTCCATGAACTGTTCCTCCCTTTTCTCTGCTTTTCT
CCTCTCTGTTCCTCTTTTAATACCACACGTCTGTTGCTTGCATTTAGTTTGTCTTCTTCC
TTCAGCTGTGTATCCCAGACTGTTAATACAGAAAAGAGACATTTCAGCTGTGATTATGAC
CATTGTTTCATATTCCAATTAAAAAAAGAACAGCAGCCTAGCTACTTAAGGTGGGGATTT
CCATAGTTCCAAAGAAGATTTAGCAGATTAGAGTGAGTTCACACTTTTCAGGTGCCACTG
TAAGGTTCTCTCAGCCTGGGAAACTATCAACTCTTTCTTTAAAAAGAAAGAGGGTTGAAA
ATCCTCTGGACGAACAGAAGTCACTTTGGCTGTTCAGTAAGGCCAATGTTAACAACACGT
TTAGAGGAGGAAAAGTTCAACCTCAAGTTAAATGGTTTGACTTATTCTTCGTATCATTAG
AAGAACCCCAGAGATAGCATTCCTCTATTTTATTTTACTTTCTTTTGGATTGCACTGATT
GTTTTTGTGGGAATGACACTTTATCTGGCAAAGTAACTGAGAGTTTGGTAAAAGAATATT
TTCTTCTCTGAATAATAATTATTTTCACAGTGAAAATTTCAGTATTTTATCACTAATGTA
TGAGCAATGATCTATATCAATTTCAAGGCACGTGAAAAAAATTTTTTAGTATGTGCAATT
TAATATAGAAAGATTTCTGCCTGTTTGGACAATAGGTTTTGGGTAGTACAGATTAGGATA
AGTAAGCTTATATATGCACAGAGATTATTGTATTACCTGTAAATTGATTTACAAGTACTT
AAAAGCGTGGTCCCCAGTGAGGCCAAGAAAGTTTCCGGTTAAGTTCTTTAATAATAATCC
TACAGTTTATCTTAAGAA
aaaaaaaaaggtttgaaaaaaacactttaatttaggcttcgttggttgatggtggaaaaa
aatgctcaggaaatatttcagatatttgccaaaaaaccagtaataaggttaccttattaa
aatagtgatatttgctttactatttaaggtgtcactgataaattaatttgtacttctgtg