Gene DDIT3 Variant 1
DNA : 3.92 KbNT_029419
mRNA : 899 bp NM_004083
CDS : 510 bp NP_004074
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  94 bp
cgaccccctagcgagagggagcgacgggggcggtgccgcggggctcctgagtggcggatg
cgagggacggggcggggccaatgccggcgtgccactttctgattggtaggttttggggtc
ccgcccctgagaggagggcaaggccatggtaaaagattacagccaggcgctcccgaggtc
AGAGACTTAAGTCTAAGGCACTGAGCGTATCATGTTAAAGATGAGCGGGTGGCAGCGACA
GAGCCAAAATCAGAGCTGGAACCTGAGGAGAGAG
gcgagtactgattcccatctaccttttaccctcccgtctcctcaaagttggggcgtccgc
tctttaggatcggcctcactcctccacagtgaagttagggaccgtccgagagaggaatgg
ggagagtcccttattctggggtggtgcttacaaacccctattgcttcggacgacggcgtc
EXON 2  48 bp
aatcacttgaaccgaggaggcagaggttgcagtgagccgagatcgcaccactgcacttca
gcctggcaacagagcaagacttggtctcaaaaaaaaaaaaagaaagaaaaaaagaaaaag
aaaagtaagttgcctctcccccttccaaaaatggctgacatttctctttgttgcccacag
TGTTCAAGAAGGAAGTGTATCTTCATACATCACCACACCTGAAAGCAG
gtaaacttaacctacccttttccaaaaattttaaacggcaggacagtaaatattttagat
gttaaaagtcctatagtctctagcgtgactcttcatctctgccactgtagcaccaaagca
gccataaacaatatgtaaataaacagatgtggctgtattccagtacaactttacctacaa
EXON 3  170 bp
actcttcatctctgccactgtagcaccaaagcagccataaacaatatgtaaataaacaga
tgtggctgtattccagtacaactttacctacaaaaacaggcatcagaccagcttgccaac
ttgtggcatagactgtttgctacatggagcttgttccagccactccccattatcctgcag
ATGTGCTTTTCCAGACTGATCCAACTGCAGAGATGGCAGCTGAGTCATTGCCTTTCTCCT
TCGGGACACTGTCCAGCTGGGAGCTGGAAGCCTGGTATGAGGACCTGCAAGAGGTCCTGT
CTTCAGATGAAAATGGGGGTACCTATGTTTCACCTCCTGGAAATGAAGAG
gtaagaatgttagccctaaagctaaagggggatgttacctttcccttctcaactaatatc
tatgttccctttcctcatttccttgaaggaagaatcaaaaatcttcaccactcttgaccc
tgcttctctggcttggctgactgaggaggagccagaaccagcagaggtcacaagcacctc
EXON 4  587 bp
gggagctggaagcctggtatgaggacctgcaagaggtcctgtcttcagatgaaaatgggg
gtacctatgtttcacctcctggaaatgaagaggtaagaatgttagccctaaagctaaagg
gggatgttacctttcccttctcaactaatatctatgttccctttcctcatttccttgaag
GAAGAATCAAAAATCTTCACCACTCTTGACCCTGCTTCTCTGGCTTGGCTGACTGAGGAG
GAGCCAGAACCAGCAGAGGTCACAAGCACCTCCCAGAGCCCTCACTCTCCAGATTCCAGT
CAGAGCTCCCTGGCTCAGGAGGAAGAGGAGGAAGACCAAGGGAGAACCAGGAAACGGAAA
CAGAGTGGTCATTCCCCAGCCCGGGCTGGAAAGCAGCGCATGAAGGAGAAAGAACAGGAG
AATGAAAGGAAAGTGGCACAGCTAGCTGAAGAGAATGAACGGCTCAAGCAGGAAATCGAG
CGCCTGACCAGGGAAGTAGAGGCGACTCGCCGAGCTCTGATTGACCGAATGGTGAATCTG
CACCAAGCATGAACAATTGGGAGCATCAGTCCCCCACTTGGGCCACACTACCCACCTTTC
CCAGAAGTGGCTACTGACTACCCTCTCACTAGTGCCAATGATGTGACCCTCAATCCCACA
TACGCAGGGGGAAGGCTTGGAGTAGACAAAAGGAAAGGTCTCAGCTTGTATATAGAGATT
GTACATTTATTTATTACTGTCCCTATCTATTAAAGTGACTTTCTATG
agccaaggtcttttactttttcttcttgcctttaggggcttcagggggtttcccctcagc
tacagccaactgtttctttagatccaagagtttcgccacctccgcagcaacctcgttctt
gtctgccttttgtgctttcagttctcggacaatgtttccctaagataaaggggggtgggg