Gene DCD Variant 1
DNA : 3.71 KbNT_029419
mRNA : 457 bp NM_053283
CDS : 333 bp NP_444513
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  117 bp
agctgctgtccaggacctacctgcagggaaggcgggcaccagccagccccagccagcctt
tgttgacttaacaggtggctctgaggtgggagaagaggaggaggagaacacaccactgga
agactggttcccattggtccctgtcatgcttaaaaaaaggcccagagaggcagtcttgac
ACCCTAGATCCCAAGATCTCCAAGGATTTGGTGGCATACCCACTCCAGCACACAGAAGCA
TGAGGTTCATGACTCTCCTCTTCCTGACAGCTCTGGCAGGAGCCCTGGTCTGTGCCT
gtgagtatggctcttccccgacacccaaccatatagtcccctgaagactgggccctgcct
tcatttccccttcccctcctcgccagaggcagttcacccaagtctgtctctgtagcccac
tcctgcctcccactaggttctccacacagggactctatggtcagaggaagccaggagccc
EXON 2  39 bp
atttggttgagataccaaaaagcatttctagtgggccccttgtgaagcagagatttctct
cctgtctgtccactgccacactcctgagattagaggcctgggaattctaggcagccctgg
ctggatacagctcatgcaactgtgccctacttgacatggtcactgttccctcctttgcag
ATGATCCAGAGGCCGCCTCTGCCCCAGGATCGGGGAACC
gtgagtcctttctcttcctcctgccccagtcctgggtgggagggttaatgacttgggata
tgagtggaggaagtcagagaagcagaaggggggtccggggaaggagagttgggaggccga
cttttaggagacatggagaagggagacttcctgagagactcatgcactggagaaggacag
EXON 3  102 bp
gaaaaagcttgagggatgctaaagaacctaacacatcatgaaagtcaagctctagaggaa
ttgggagagagggagctatcctcaagccagaccttgagggggtaaaagcaccacctgctc
cccgaccagggtggaaagagtgaaatagctattattcctctcactcccttacccttgcag
CTTGCCATGAAGCATCAGCAGCTCAAAAGGAAAATGCAGGTGAAGACCCAGGGTTAGCCA
GACAGGCACCAAAGCCAAGGAAGCAGAGATCCAGCCTTCTGG
gtaagcctctttcccaatgcctggtatagaattctgatgcatgaaacagcaagatatctg
ggggccagtctgccctcacaggcacaagcacagggacacagctacacccatattcctagg
gagggcttggggtgcacacctgcttctacatacagggtttctgggccataggttttgcag
EXON 4  90 bp
ggccataggttttgcagctaatactggcctaccaaccttcccatgacagagaagttggtt
ccttcagcaaaaccacttcaccttaggggtgcccatggtgcctaggaagcgggggagctc
tcctacaaaggaagtagtttttctgcttctatgacctcttcttttctgaatccaccctag
AAAAAGGCCTAGACGGAGCAAAAAAAGCTGTGGGGGGACTCGGAAAACTAGGAAAAGATG
CAGTCGAAGATCTAGAAAGCGTGGGTAAAG
gtgagtatatgtccccactcctccctcaggaccagcctcagtctccaccccttgcatgag
atctgaaactgccacagcccccccattgaagacccctcactttgtgctttcaaatgtctc
caattcctcatccagatttaaattgccattcttgtctgatattgatacttcctggggtct
EXON 5  109 bp
aggttggtctttggggctcctgtgaatctaacctccatccctctgacttctgtgtaagca
cctccaggcctcccttccccttccccttcccctacctctccttccccaattccctggctc
tctttcccttccttttttcttcctacccctttaccccatttttttctgtggctgtcctag
GAGCCGTCCATGACGTTAAAGACGTCCTTGACTCAGTACTATAGCTGTAAGGAGAAGCTG
AGAAATGATACCCAGGAGCAGCAGGCTTTACGTCTTCAGCCTAAAACCT
aaaaaaaaaaaaaaaaaaaaaaatttaaaacagctattaaactgaaagcatctgtaatac
ttggagtatgtgtgtgttttccttaagaagagatggggtatgaaacctggccaggagccc
aaaaggttggaagagcactccatgaggcttcaattggcaccctggcccttcctcccgaaa