Gene CDKN1B Variant 1
DNA : 4.99 KbNT_009714
mRNA : 2403 bp NM_004064
CDS : 597 bp NP_004055
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  940 bp
caatctcccggcggcgctcggggaggcggcgcgctcgggaacgaggggaggtggcggaac
cgcgccggggccaccttaaggccgcgctcgccagcctcggcggggcggctcccgccgccg
caaccaatggatctcctcctctgtttaaatagactcgccgtgtcaatcattttcttcttc
GTCAGCCTCCCTTCCACCGCCATATTGGGCCACTAAAAAAAGGGGGCTCGTCTTTTCGGG
GTGTTTTTCTCCCCCTCCCCTGTCCCCGCTTGCTCACGGCTCTGCGACTCCGACGCCGGC
AAGGTTTGGAGAGCGGCTGGGTTCGCGGGACCCGCGGGCTTGCACCCGCCCAGACTCGGA
CGGGCTTTGCCACCCTCTCCGCTTGCCTGGTCCCCTCTCCTCTCCGCCCTCCCGCTCGCC
AGTCCATTTGATCAGCGGAGACTCGGCGGCCGGGCCGGGGCTTCCCCGCAGCCCCTGCGC
GCTCCTAGAGCTCGGGCCGTGGCTCGTCGGGGTCTGTGTCTTTTGGCTCCGAGGGCAGTC
GCTGGGCTTCCGAGAGGGGTTCGGGCTGCGTAGGGGCGCTTTGTTTTGTTCGGTTTTGTT
TTTTTGAGAGTGCGAGAGAGGCGGTCGTGCAGACCCGGGAGAAAGATGTCAAACGTGCGA
GTGTCTAACGGGAGCCCTAGCCTGGAGCGGATGGACGCCAGGCAGGCGGAGCACCCCAAG
CCCTCGGCCTGCAGGAACCTCTTCGGCCCGGTGGACCACGAAGAGTTAACCCGGGACTTG
GAGAAGCACTGCAGAGACATGGAAGAGGCGAGCCAGCGCAAGTGGAATTTCGATTTTCAG
AATCACAAACCCCTAGAGGGCAAGTACGAGTGGCAAGAGGTGGAGAAGGGCAGCTTGCCC
GAGTTCTACTACAGACCCCCGCGGCCCCCCAAAGGTGCCTGCAAGGTGCCGGCGCAGGAG
AGCCAGGATGTCAGCGGGAGCCGCCCGGCGGCGCCTTTAATTGGGGCTCCGGCTAACTCT
GAGGACACGCATTTGGTGGACCCAAAGACTGATCCGTCGGACAGCCAGACGGGGTTAGCG
GAGCAATGCGCAGGAATAAGGAAGCGACCTGCAACCGACG
gtaatgaccctttcccaaccatagaatgtgtttggggccccgctttgcctgctggagggt
gttaaccttagcttgcttttcggcgtattctgatttagctttgggagagctaactttatt
ggtcttaggtgttcagtgctacctggcccactgcttgtctgtttgtgacttttaagtcag
EXON 2  130 bp
ttctgttttttgaaaacaacctcattttgtgcccttaaaagccactggggatgacggatc
caggattgtgggtggaggtagtgggtttttcatcccctgactatggggccaacttctgcc
agccattgttttttctaataaagattgtgtgttctttttaaaaatttcccctgcgcttag
ATTCTTCTACTCAAAACAAAAGAGCCAACAGAACAGAAGAAAATGTTTCAGACGGTTCCC
CAAATGCCGGTTCTGTGGAGCAGACGCCCAAGAAGCCTGGCCTCAGAAGACGTCAAACGT
AAACAGCTCG
gtgggttgatcactaaaggagcacgcactggaacccggggccttcagacctcacgatacc
tgatcttactggttgctggcaaattaaaagcttatggggttttgttttgtttatacttcg
tgaggtcaaaaaagtagcaatggggaaggctggggatacggtaattcctcagagtttcta
EXON 3  1333 bp
gaggaaaggaaaaaaaaatccagttaagagaatgttaggtggagatgactatagtcatca
aacttttttccccatcaagtatttccaagctaacatagtgacaaaataattcctgtactc
tactggtaacgttaatctagtgctcttcctttaattcttccgttttgttttcttttgcag
AATTAAGAATATGTTTCCTTGTTTATCAGATACATCACTGCTTGATGAAGCAAGGAAGAT
ATACATGAAAATTTTAAAAATACATATCGCTGACTTCATGGAATGGACATCCTGTATAAG
CACTGAAAAACAACAACACAATAACACTAAAATTTTAGGCACTCTTAAATGATCTGCCTC
TAAAAGCGTTGGATGTAGCATTATGCAATTAGGTTTTTCCTTATTTGCTTCATTGTACTA
CCTGTGTATATAGTTTTTACCTTTTATGTAGCACATAAACTTTGGGGAAGGGAGGGCAGG
GTGGGGCTGAGGAACTGACGTGGAGCGGGGTATGAAGAGCTTGCTTTGATTTACAGCAAG
TAGATAAATATTTGACTTGCATGAAGAGAAGCAATTTTGGGGAAGGGTTTGAATTGTTTT
CTTTAAAGATGTAATGTCCCTTTCAGAGACAGCTGATACTTCATTTAAAAAAATCACAAA
AATTTGAACACTGGCTAAAGATAATTGCTATTTATTTTTACAAGAAGTTTATTCTCATTT
GGGAGATCTGGTGATCTCCCAAGCTATCTAAAGTTTGTTAGATAGCTGCATGTGGCTTTT
TTAAAAAAGCAACAGAAACCTATCCTCACTGCCCTCCCCAGTCTCTCTTAAAGTTGGAAT
TTACCAGTTAATTACTCAGCAGAATGGTGATCACTCCAGGTAGTTTGGGGCAAAAATCCG
AGGTGCTTGGGAGTTTTGAATGTTAAGAATTGACCATCTGCTTTTATTAAATTTGTTGAC
AAAATTTTCTCATTTTCTTTTCACTTCGGGCTGTGTAAACACAGTCAAAATAATTCTAAA
TCCCTCGATATTTTTAAAGATCTGTAAGTAACTTCACATTAAAAAATGAAATATTTTTTA
ATTTAAAGCTTACTCTGTCCATTTATCCACAGGAAAGTGTTATTTTTCAAGGAAGGTTCA
TGTAGAGAAAAGCACACTTGTAGGATAAGTGAAATGGATACTACATCTTTAAACAGTATT
TCATTGCCTGTGTATGGAAAAACCATTTGAAGTGTACCTGTGTACATAACTCTGTAAAAA
CACTGAAAAATTATACTAACTTATTTATGTTAAAAGATTTTTTTTAATCTAGACAATATA
CAAGCCAAAGTGGCATGTTTTGTGCATTTGTAAATGCTGTGTTGGGTAGAATAGGTTTTC
CCCTCTTTTGTTAAATAATATGGCTATGCTTAAAAGGTTGCATACTGAGCCAAGTATAAT
TTTTTGTAATGTGTGAAAAAGATGCCAATTATTGTTACACATTAAGTAATCAATAAAGAA
AACTTCCATAGCT
attcattgagtcaaattgtaatgtgctttaccaaacaaggtatttgacctggcattctag
tcatatttacacaaatgtaaatgtgaagtggcaaatacctaggtaattcaggcccacaac
tcagatgatgttttatgtagtccgaatgtagttagcagttactgttttccacttagctct