Gene CDK2AP1 Variant 1
DNA : 11.15 KbNT_009755
mRNA : 1611 bp NM_004642
CDS : 348 bp NP_004633
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  577 bp
ttggatccccaaagggttaaaaaccacttcatacagacagagacatgaaatttatttgaa
atcaatgtcaagcatcggttattctaatcctggggcttggccagacctgggcgtctggaa
tgatctacgtgcttaaatacaccactcgccaccattttctccaggtaattttccatccct
GCCCCCACCATCAAGGGGAAGAAAGTGCTCTTCGGATTCCGGTTCGCCCTGGCCTCCCGC
AGCCGCCGCGGGACCGGCCCCCAGCACACCCCCGGGGCGCCGGGCGCGGGGCAGCCGCCC
GGACGCGCGCGGGCCTCAGGCGCCGCCGGGACCCCAGCCCCCCAAACTTTGGCAAGTTGC
GGGCGCCGAGCGCACCCGGAGGCGCGGGGCGCGGCCGCAGGCGGAGCCGCCCCCTGACGC
CGGGCCGCCCCCTCCCGGCCCCGGCCGCCCCGCCGGCTCCGCGGAAAGTTTGCGGCCGCC
CCTGCGCCGCACCCGGGGCCTGGGTGAGACTGCGGCGGCGGCAGGGCGCGGACGGCCATA
TTTGCCGGCGCGGCCCGAGCCGCCGACAACAAAAAGTGCGCGGGCGCTCGGCGGGCGCTC
GGACGGGCGCGGGGCTGCAGCGCTACCGCCCGGCCTCGCCGCCGCCGCCGCCGCCCTCGC
GGCCTGGCCCCGCCGCGCCCGGCGCGCCCGCCGCCCGGGGGGATGTCTTACAAACCGAAC
TTGGCCGCGCACATGCCCGCCGCCGCCCTCAACGCCG
gtgagtgagccgcgtgcgacgcgccccaagcgccgccaagttgggggtccgcgcgcccgg
ccccggcccggggatgcccggggcgcccgcggaggccgggggcggggggctcagggtccc
ggcccggggcagcgctgccgccgccatgattcccgagcccgcgccgcgaaagttctctgg
EXON 2  98 bp
tgtagctacatttcattatccatcttatatgctggtcaaaccggaggtggagagcagggt
tctccatcctgctacagttggtggtgtgggtcctgggcaagggctgttgcaggacccgga
gtccttgccttggtacaactggctgagctgactcctggcctctctctccccaccccacag
CTGGGAGTGTCCACTCGCCTTCCACCAGCATGGCAACGTCTTCACAGTACCGCCAGCTGC
TCAGTGACTACGGGCCACCGTCCCTAGGCTACACCCAG
gtatgtcaatgggggtgatggcatggtgggagggccagggggagacatgcttcccaccat
cagaggagagaagttggtggaagagacgaaggagcagaaaggatgggacggagctttctc
agcccaaggccctggctgcgctcctgctcagaacacatcagagtggagggcactggggac
EXON 3  127 bp
gagatggagtctcgctctgttgcccaggctggagtgcagtggagtgatcttggctcactg
caacttccacctcctgggtccaagcagttctcctgcctcagcctcctgagtaactgggac
tacaggcacgcaccaccacgcccggctgattttgctgaacccatttctttctgattctag
GGAACTGGGAACAGCCAGGTGCCCCAAAGCAAATACGCGGAGCTGCTGGCCATCATTGAA
GAGCTGGGGAAGGAGATCAGACCCACGTACGCAGGGAGCAAGAGTGCCATGGAGAGGCTG
AAGCGCG
gtaagcccggccccgctgccctgtcggtgaccacagtgctagacctttaactctggaaag
acttttggggaaaatgtgggaaggtgggctagggatgaggctcactcatgggagctcctg
tcttgttacagagttgccgtctgtggtggaggcctcaggcaggcgatgggtctggtagcg
EXON 4  809 bp
agagggatgggattgttagcgtccttcagggttgcttggttataggtttccctggttctc
tttatgtctgagggttttgtggacaggctgtggaaggatggatcctcttgctgtttcaga
atgggctttgctggctggtcctgtgcacttgctgacctcaggtctctgcctctgtttcag
GCATCATTCACGCTAGAGGACTGGTTCGGGAGTGCTTGGCAGAAACGGAACGGAATGCCA
GATCCTAGCTGCCTTGTTGGTTTTGAAGGATTTCCATCTTTTTACAAGATGAGAAGTTAC
AGTTCATCTCCCCTGTTCAGATGAAACCCTTGTTTTCAAAATGGTTACAGTTTCGTTTTT
CCTCCCATGGTTCACTTGGCTCTGAACCTACAGTCTCAAAGATTGAGAAAAGATTTTGCA
GTTAATTAGGATTTGCATTTTAAGTAGTTAGGAACTGCCCAGGTTTTTTTTGTTTTTTAA
GCATTGATTTAAAAGATGCACGGAAAGTTATCTTACAGCAAACTGTAGTTTGCCTCCAAG
ACACCATTGTCTCCCTTTAATCTTCTCTTTTGTATACATTTGTTACCCATGGTGTTCTTT
GTTCCTTTTCATAAGCTAATACCACTGTAGGGATTTTGTTTTGAACGCATATTGACAGCA
CGCTTTACTTAGTAGCCGGTTCCCATTTGCCATACAATGTAGGTTCTGCTTAATGTAACT
TCTTTTTTGCTTAAGCATTTGCATGACTATTAGTGCTTCAAAGTCAATTTTTAAAAATGC
ACAAGTTATAAATACAGAAGAAAGAGCAACCCACCAAACCTAACAAGGACCCCCGAACAC
TTTCATACTAAGACTGTAAGTAGATCTCAGTTCTGCGTTTATTGTAAGTTGATAAAAACA
TCTGGAAGAAAATGACTAAAACTGTTTGCATCTTTGTATGTATTTATTACTTGATGTAAT
AAAGCTTATTTTCATTAACAATTTGTATT
aaaatgtgggttccttgaattcttacgtgctgttttatttttttgagacagggtcttgtt
ttgccacccaggctggagtgcagtaatataatcttggctcaccgcagcctcaacctcctg
ggctcaagcaatcctcccatctcagcctccctagtggctggaactacaggtgtgtgccac