--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (19795 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (16 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       4737       4867   0    Initial    131   100   Excellent
aggggaaagaaccaagattagcagtaggatcaacatatattttaatgttttctgtatttt
tattacttgtataatttaaacattttaaattagtaataatgaacaatcatgaaactatgg
atgatttagtccagcaaaatatccaattgggaaccctcatccttctgacgcagagcccaa
ATGGCGCAGTGGGAAATGCTGCAGAATCTTGACAGCCCCTTTCAGGATCAGCTGCACCAG
CTTTACTCGCACAGCCTCCTGCCTGTGGACATTCGACAGTACTTGGCTGTCTGGATTGAA
GACCAGAACTG
gtgaggccttcaggaagttgggggaatgaaaaaggtggttccttacttctgggcccccgg
gatcctggaatcattaatggcaggaaggggttggaaagcctcaggactacagtaacactg
cagagacactaatacttcttattcctggtgcccaggcaggaagctgcacttgggagtgat

Exon  2 +       5023       5176   2   Internal    154    93   Excellent
ctgtctggattgaagaccagaactggtgaggccttcaggaagttgggggaatgaaaaagg
tggttccttacttctgggcccccgggatcctggaatcattaatggcaggaaggggttgga
aagcctcaggactacagtaacactgcagagacactaatacttcttattcctggtgcccag
GCAGGAAGCTGCACTTGGGAGTGATGATTCCAAGGCTACCATGCTATTCTTCCACTTCTT
GGATCAGCTGAACTATGAGTGTGGCCGTTGCAGCCAGGACCCAGAGTCCTTGTTGCTGCA
GCACAATTTGCGGAAATTCTGCCGGGACATTCAG
gtacttggaacggttgggagtgatggggtagcactgggagctgagcatagaggagtaagg
tttggagaatagaatagtacctggaggtggaaagggagacgggaacaaatgtggggaaag
gaggacagagtctggacttggggaatcactagcagagagaagggttgcatatacgtgaca

Exon  3 +       5776       5865   0   Internal     90    62    Marginal
aattggtgaggacaattcagtggtaatgttggaaactcctgaagtagagaggaaccatgg
aaaggactcagggagttgtctcagaacaggatccccccgacatcctgtggtataatttca
ggcctgaacttaaggcatgaaaggccagagttaaaacgtgctcagagcctcttttttcag
GAACAAGGAGAGCCAGTTCTCGAAACACCTGTGGAGAGCCAGCAACATGAGATTGAATCC
CGGATCCTGGATTTAAGGGCTATGATGGAG
gttagtagatgtggtaggagttagggttgacagcgttcagcctaacacctccctgagaag
cagcctcatcggggtcctctcccctctgcagaagctggtaaaatccatcagccaactgaa
agaccagcaggatgtcttctgcttccgatataagatccaggccaaaggtaggaagcacat

Exon  4 +       5957       6032   0   Internal     76    78        Good
aacaaggagagccagttctcgaaacacctgtggagagccagcaacatgagattgaatccc
ggatcctggatttaagggctatgatggaggttagtagatgtggtaggagttagggttgac
agcgttcagcctaacacctccctgagaagcagcctcatcggggtcctctcccctctgcag
AAGCTGGTAAAATCCATCAGCCAACTGAAAGACCAGCAGGATGTCTTCTGCTTCCGATAT
AAGATCCAGGCCAAAG
gtaggaagcacattgaggggctggagaaagataagtgcctgctgagaagccggagctgga
agtgaacaggagaaagctccgatgagcagtagtcactgtcagacacaccccactgactac
agtcctgctgccgtgcaaagctggaagtgctttgtggaggctgagctggaggtgcagctg

Exon  5 +       6445       6530   1   Internal     86   100   Excellent
agggggtgtctggtccaagcatgaccattcagaatttgcctgagggtcccacaggtgcct
gtgctttgcttggtttccctttcttcctccacaaaattcctccttcctgactctgactga
gaccccagtcaggaaggagaggaaagaacccctggactgactcctgttcccaccatccag
GGAAGACACCCTCTCTGGACCCCCATCAGACCAAAGAGCAGAAGATTCTGCAGGAAACTC
TCAATGAACTGGACAAAAGGAGAAAG
gtgggagacagaggacagaacatgtgggcaacaaggacctggaaaaatgagggatgtggg
gaccctggtcctctagcgctggcttctttgtttcttcatccccagttgggtggtggaggg
tgaaagggagagatgctcaacactcacattatctctttcccaggaggtgctggatgcctc

Exon  6 +       6694       6842   0   Internal    149   100   Excellent
tggacaaaaggagaaaggtgggagacagaggacagaacatgtgggcaacaaggacctgga
aaaatgagggatgtggggaccctggtcctctagcgctggcttctttgtttcttcatcccc
agttgggtggtggagggtgaaagggagagatgctcaacactcacattatctctttcccag
GAGGTGCTGGATGCCTCCAAAGCACTGCTAGGCCGATTAACTACCCTAATCGAGCTACTG
CTGCCAAAGTTGGAGGAGTGGAAGGCCCAGCAGCAAAAAGCCTGCATCAGAGCTCCCATT
GACCACGGGTTGGAACAGCTGGAGACATG
gtgagaggtaccaccccaaccctcgtcctcgccatgcgctgtgatttgtaagttgcagtg
ccctgcatatagcaagagatactgttctctatttgtctctgctccccagaatgagccctg
ctccctgctgactgcagctctattctgctcctcatcctcaccacgcagggagcccagagc

Exon  7 +       9858      10016   2   Internal    159    83        Good
attttcatttcttggattatgaatcatgttgaataatcctttatatgcttcctggattct
ttttttttcttccccccagtcagtttctgactcttcacatatttacagagagatcttgga
acctggatgggggaatccaggaaactcatggattccttcttcctgaattttatcacccag
GTTCACAGCTGGAGCAAAGCTGTTGTTTCACCTGAGGCAGCTGCTGAAGGAGCTGAAGGG
ACTGAGTTGCCTGGTTAGCTATCAGGATGACCCTCTGACCAAAGGGGTGGACCTACGCAA
CGCCCAGGTCACAGAGTTGCTACAGCGTCTGCTCCACAG
gtctagaggccaggcaggaaccctgggggaaagaaggaacaagggaagccattcttacag
atactgagctatatattctctccacacctctctctcctcagagcctttgtggtagaaacc
cagccctgcatgccccaaactccccatcgacccctcatcctcaagactggcagcaagttc

Exon  8 +      10118      10210   2   Internal     93    78        Good
atcaggatgaccctctgaccaaaggggtggacctacgcaacgcccaggtcacagagttgc
tacagcgtctgctccacaggtctagaggccaggcaggaaccctgggggaaagaaggaaca
agggaagccattcttacagatactgagctatatattctctccacacctctctctcctcag
AGCCTTTGTGGTAGAAACCCAGCCCTGCATGCCCCAAACTCCCCATCGACCCCTCATCCT
CAAGACTGGCAGCAAGTTCACCGTCCGAACAAG
gttggcattccagaactcattcccacttcctttttccaaccctgccactgtgtattttct
ggctttacagctcttcccactcttggctttttcttctctttccctgcaatctccctacct
cttataatccctcttctctttttcaaacatctagtctatccggaaggttgaggttgacca

Exon  9 +      10420      10479   2   Internal     60    87        Good
ctttttccaaccctgccactgtgtattttctggctttacagctcttcccactcttggctt
tttcttctctttccctgcaatctccctacctcttataatccctcttctctttttcaaaca
tctagtctatccggaaggttgaggttgaccactttcccctatcccccttccttcccccag
GCTGCTGGTGAGACTCCAGGAAGGCAATGAGTCACTGACTGTGGAAGTCTCCATTGACAG

gtaaattggagcaggtgaagggtggccaggacacgggctgctggggtggaggagatactc
actcttcacaacagggccctagggctatctccttcctccttccaatcctacctcacagaa
attataattcatttcttttgttgaacacttactttgtgacatgcagcatgtcagctactc

Exon 10 +      11118      11211   2   Internal     94    78        Good
atgacctgcagaaccacattcggcagccctggtggcacaaacaaggaagagggggatttg
ggatatggacaaagggagatggcgagatctgaaatgaagtggaacttctgtttttttttt
tctgctgagtttttagaataattccattccttgtctccatgtatcttcctcctggaacag
CTTCCGGAAGTTCAACATTCTGACTTCAAACCAGAAAACTTTGACCCCCGAGAAGGGGCA
GAGTCAGGGTTTGATTTGGGACTTTGGTTACCTG
gtaagaatagtttgtgacctatgcttttattactatttttatttttttgagacggagtct
cactctgtcccccaggctggagtgcagtggtgccatcttggctcacagcaacctccgcct
cccgggttcaagcaattcttctgtctcagcctcctgagtagctgagactataggcacaca

Exon 11 +      12047      12145   0   Internal     99    67    Marginal
gaagcaggagctgaaagtgagtgaaaatggagggcaaggagagagaaagcagctttggaa
gaaggcataagaaggggataaacagaagcctcttggggtgggttagcactcctttcctct
aacaaatacctgcagctagaaacatcacatccctctctgtgactcctgtcttctccccag
ACGGACACCCTCCCTGTGGTGATTATTTCCAACATGAACCAGCTCTCAATTGCCTGGGCT
TCAGTTCTCTGGTTCAATTTGCTCAGCCCAAACCTTCAG
gtaggggagtggggccgacaggtcaaggcgcgagaggaggggtgtggaagcttggtgtga
taggttgcttctgagccagcctacactgctcccacccctgcagaaccagcagttcttctc
caacccccccaaggccccctggagcttgctgggccctgctctcagttggcagttctcctc

Exon 12 +      12249      12379   0   Internal    131    87        Good
ttatttccaacatgaaccagctctcaattgcctgggcttcagttctctggttcaatttgc
tcagcccaaaccttcaggtaggggagtggggccgacaggtcaaggcgcgagaggaggggt
gtggaagcttggtgtgataggttgcttctgagccagcctacactgctcccacccctgcag
AACCAGCAGTTCTTCTCCAACCCCCCCAAGGCCCCCTGGAGCTTGCTGGGCCCTGCTCTC
AGTTGGCAGTTCTCCTCCTATGTTGGCCGAGGCCTCAACTCAGACCAGCTGAGCATGCTG
AGAAACAAGCT
gttcggtacagatttccttttctctcagcctttccccagccttagtcttttctgtccctc
tgtcctatctatcccaggacccctggcttccctcatcatctgtctgtggctatctgtccc
acagggcagaactgtaggactgaggatccattattgtcctgggctgacttcactaaggta

Exon 13 +      14353      14489   2   Internal    137    86        Good
tggctattgtcagcaaagtgaagtgacttgtaaaagataaaaaaaagctaagtggcaggg
cttggtccaaagcctggattccaaacctgggctgtttctccatacaaggggagcagggag
gcaggggcctggtggggcagggtgttgggcggtgtctcacagctgctctctgtgctccag
ACGCATCATGGGCTTTGTGAGTCGGAGCCAGGAGCGCCGGCTGCTGAAGAAGACCATGTC
TGGCACCTTTCTACTGCGCTTCAGTGAATCGTCAGAAGGGGGCATTACCTGCTCCTGGGT
GGAGCACCAGGATGATG
gtcagctgctctgccctgccattcccacagcctctcctttctgcctggctcccctcttgc
ccctctgcctgcccttggcttccctggctctgaactgaatccctcagctggtttgggact
gggcagccagagcagagagctccaaggcccggcctcttccctcaagcccgcctgttcctg

Exon 14 +      14684      14846   1   Internal    163   100   Excellent
cctgccattcccacagcctctcctttctgcctggctcccctcttgcccctctgcctgccc
ttggcttccctggctctgaactgaatccctcagctggtttgggactgggcagccagagca
gagagctccaaggcccggcctcttccctcaagcccgcctgttcctgcattcactctccag
ACAAGGTGCTCATCTACTCTGTGCAACCGTACACGAAGGAGGTGCTGCAGTCACTCCCGC
TGACTGAAATCATCCGCCATTACCAGTTGCTCACTGAGGAGAATATACCTGAAAACCCAC
TGCGCTTCCTCTATCCCCGAATCCCCCGGGATGAAGCTTTTGG
gtgctactaccaggagaaaggtgggaatcgttgacatacttcattgctagattgcagaga
tctaccagacatccatagatcccactccttcctttaaagcatgggaaaactgatatctag
aggaattaagggattcgtccatgggatactgctggttactatggggatgagactgccagg

Exon 15 +      17173      17353   2   Internal    181    88        Good
ttaggccacttgcctaaggtcccccagccaggattcaaactccaggaggcctgattccaa
acccatgctctttagccctccgccctactgccttcttagactagcttctgcttattctac
cattcctgatttcatttgaaccactgagccctgcccctttgtctgtctttgggtatccag
ACAGGTGGATGAACTGCAACAACCGCTGGAGCTTAAGCCAGAGCCAGAGCTGGAGTCATT
AGAGCTGGAACTAGGGCTGGTGCCAGAGCCAGAGCTCAGCCTGGACTTAGAGCCACTGCT
GAAGGCAGGGCTGGATCTGGGGCCAGAGCTAGAGTCTGTGCTGGAGTCCACTCTGGAGCC
T
gtgatagagcccacactatgcatggtatcacaaacagtgccagagccagaccaaggacct
gtatcacagccagtgccagagccagatttgccctgtgatctgagacatttgaacactgag
ccaatggaaagtaagtgatgagatggagctatggaagatggcacacattccctttcctac

Exon 16 +      17777      17919   1   Terminal    143    68    Marginal
ttctgtgattcctttttttaggaattacacatgccttcccccacctccctgctctttcat
cccacaagttcccactcaggctcttcccaggcctttcctgccatcctccctccctttccc
tgctgggttgggaactcctaactaagatcggggcctcacttttctctctggattacctag
TCTTCAGAAACTGTGTAAAGATTGAAGAAATCATGCCGAATGGTGACCCACTGTTGGCTG
GCCAGAACACCGTGGATGAGGTTTACGTCTCCCGCCCCAGCCACTTCTACACTGATGGAC
CCTTGATGCCTTCTGACTTCTAG
gaaccacatttcctctgttcttttcatatctcttgcccttcctactcctcatagcatgat
attgttctccaaggatgggaatcaggcatgtgtcccttccaagctgtgttaactgttcaa
actcaggcctgtgtgactccattggggtgagaggtgaaagcataacatgggtacagaggg

--------------------------------------------------------------------------------