--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (90065 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (15 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +      32698      32727   0   Terminal     30    93   Excellent
gcactccagcctgggcaataagagcgaaactccatctcaaaaaaaaaaaaaaaagatatg
caaggtaaagatactaataaagacctttgtgttgagttggttgacatgtggttatttcac
ccatcgtatttcttatagggaataggtaaattcgttccttgggtttctttcaacacttag
GTAAAATCCGACGTGGAAGATGAGATCTGA
ttttactggtgtaactctttatttgtccccttgcctccctttccaatggactattttaga
agaaatggagctgtcacccacatcaagattcagaacactggtgattactatgacctgtat
ggaggggagaaatttgccactttggctgagttggtccagtattacatggaacatcacggg

Exon  2 +      32773      32981   0    Initial    209   100   Excellent
aataaagacctttgtgttgagttggttgacatgtggttatttcacccatcgtatttctta
tagggaataggtaaattcgttccttgggtttctttcaacacttaggtaaaatccgacgtg
gaagatgagatctgattttactggtgtaactctttatttgtccccttgcctccctttcca
ATGGACTATTTTAGAAGAAATGGAGCTGTCACCCACATCAAGATTCAGAACACTGGTGAT
TACTATGACCTGTATGGAGGGGAGAAATTTGCCACTTTGGCTGAGTTGGTCCAGTATTAC
ATGGAACATCACGGGCAATTAAAAGAGAAGAATGGAGATGTCATTGAGCTTAAATATCCT
CTGAACTGTGCAGATCCTACCTCTGAAAG
gtcagtaacattttagtgaccacaaagtctgctgctcccttgtgccctgagtgtcagaaa
tgcatgacggtctgtgtatgactctctgactccaaaggcttgtgactgttttttgagctg
taatctttaaagaattactaaagtgagactaatagcatcaaattattttcagagtacctt

Exon  3 +      35664      35856   2   Internal    193    85        Good
tttttcctgcctgcatgggatgcagattttctgtctcaggtgggattgatcaatcccttg
gaggaatgtgtctactttttaattgtgtttaggagagctgactgtatacagtagttttgt
gaaagaacaacatgaacccatagtagagctaaattcttttttattttttaaaaactttag
GTGGTTTCATGGACATCTCTCTGGGAAAGAAGCAGAGAAATTATTAACTGAAAAAGGAAA
ACATGGTAGTTTTCTTGTACGAGAGAGCCAGAGCCACCCTGGAGATTTTGTTCTTTCTGT
GCGCACTGGTGATGACAAAGGGGAGAGCAATGACGGCAAGTCTAAAGTGACCCATGTTAT
GATTCGCTGTCAG
gtaaatctccagttgaaaaatgggtctggcaagatgttacctttgggtgatttttctgct
gacagaagacagacaccattacattcaaagtcagattgtcttttatttatttatttattt
atttatttatttgagacagggtcttgctctatcacctacagatggggtttcaccacgttg

Exon  4 +      36018      36102   0   Internal     85    74        Good
tgttatgattcgctgtcaggtaaatctccagttgaaaaatgggtctggcaagatgttacc
tttgggtgatttttctgctgacagaagacagacaccattacattcaaagtcagattgtct
tttatttatttatttatttatttatttatttgagacagggtcttgctctatcacctacag
ATGGGGTTTCACCACGTTGGGTCTGGTGACCCAAATCTTTGGGTGATTTTTCTGCTGGAA
GAGGACAAACACCATTACATTCAAA
gtcagattttctgttttttttttttttttgtttttgtttttttaatattcatttgtttat
tcatttgagactgggtcttgctctgtcacgcaggctggagtgcaacctccctgggctcag
ttgatcttccctcagcctcttgagtagctgggactacaggtgtgtgccaccatgcccagc

Exon  5 +      55413      55509   0   Internal     97    77        Good
gtgtggggattacaggtgtaagccatcacgcctgacccagatgaacattcttgtagctat
cgcacacaattctgaacatttcctaggatgaattccttaaagaagtaatgctgatccagg
cttttttctttttctgtgactctttgacacgtaataatattgacttttctttctttccag
ACACTACAACAACAGGAGTGCAAACTTCTCTACAGCCGAAAAGAGGGTCAAAGGCAAGAA
AACAAAAACAAAAATAGATATAAAAACATCCTGCCCT
gtaagtatcaatattccgctcagtaatagtcactcttggagattttgattcctagcacct
ctgtacctttcctcagggtcgtgtgctcttgttagcacatcggaggccttagcttcttta
attgcaagcagtttccaaaataatcaaccatggtgggtgttgatgacttcattcactgag

Exon  6 +      60120      60199   1   Internal     80   100   Excellent
tttgagacatcaggcagtgttcacgttactgttttgcttacctgggctttaatttttatg
tgtttttttttcaatcattgaatgaacaaaacttggactaggctggggagtaactgattt
gaactgttttttcctgaagcagtccaggacttatgtgaccgtggtctctttttcttctag
TTGATCATACCAGGGTTGTCCTACACGATGGTGATCCCAATGAGCCTGTTTCAGATTACA
TCAATGCAAATATCATCATG
gtaagctttgcttttcacagtgttttctgaccatacatttctagcctatttttgtatttt
aaatccttcctcatgtcctgaaagtaactttaaggtgtttgaaggattttcttcctaaat
ttctagcctgaatttgaaaccaagtgcaacaattcaaagcccaaaaagagttacattgcc

Exon  7 +      60326      60484   0   Internal    159    99   Excellent
gatggtgatcccaatgagcctgtttcagattacatcaatgcaaatatcatcatggtaagc
tttgcttttcacagtgttttctgaccatacatttctagcctatttttgtattttaaatcc
ttcctcatgtcctgaaagtaactttaaggtgtttgaaggattttcttcctaaatttctag
CCTGAATTTGAAACCAAGTGCAACAATTCAAAGCCCAAAAAGAGTTACATTGCCACACAA
GGCTGCCTGCAAAACACGGTGAATGACTTTTGGCGGATGGTGTTCCAAGAAAACTCCCGA
GTGATTGTCATGACAACGAAAGAAGTGGAGAGAGGAAAG
gtaaatcacagaaacttcttttctgctaaactgtttttaaagtatcagacatgtcagatt
ggccatgtttaggaattgaataaatgaattaagcttactgtaactgattctctggaaaaa
agggactaggagaaatttgattatgttattccttggtgtagttttctttatgtttcttct

Exon  8 +      64543      64674   0   Internal    132   100   Excellent
gaatgcctgcttttcttatttgaactcttctgtccttttctgaaaacctaacagatgcga
aacaggccattttccatgttggtggttattaagcaagacttgaacatttgtttgttgctt
gtttaggcttttatttcagagttcacagaattaactttctttttttctgatctcttccag
AGTAAATGTGTCAAATACTGGCCTGATGAGTATGCTCTAAAAGAATATGGCGTCATGCGT
GTTAGGAACGTCAAAGAAAGCGCCGCTCATGACTATACGCTAAGAGAACTTAAACTTTCA
AAGGTTGGACAA
gtaagtatattgtcgtattctagagactttgggaactgttgatggtgtgtaggaattcag
ggtcttgccgttactcatgtttgcatacatgcatgcattcgctcactcattgattcagta
gccatttattagcttccttctatgtgccaggtacagtttaagcagtactggtacattgtg

Exon  9 +      64825      64945   0   Internal    121    85        Good
agagaacttaaactttcaaaggttggacaagtaagtatattgtcgtattctagagacttt
gggaactgttgatggtgtgtaggaattcagggtcttgccgttactcatgtttgcatacat
gcatgcattcgctcactcattgattcagtagccatttattagcttccttctatgtgccag
GTACAGTTTAAGCAGTACTGGTACATTGTGAACAAGGCAGGTAGTGTTCCTGCCCTCATC
GAGCCTAGGGAGATAGACAATTTAAAAACAAATAACTGGCCAGGCGCCGTGGCTCAGGCC
T
gtaatcccagcactttgggaggctgaggtgggtggatcgcttgagccggggagttcgaga
ccagccctgggtgggagactgggatagggtgacctgagtggctacaaggtctgttaggag
gcctccgcaggggcctatgttgatggcctcctctccaagtatccacagacttcagcagtt

Exon 10 +      68944      69098   0   Internal    155   100   Excellent
gttgcctccaggattgcccaaaaggagacgagttctgggaacctcacgaagaggaccttt
cagtggaacctggggagattctcttcctctccattggatttaggaaagcttagaaccggg
tgattcctcaacctcttgatttatttaattcttttctggtttttcttggctctactccag
GGGAATACGGAGAGAACGGTCTGGCAATACCACTTTCGGACCTGGCCGGACCACGGCGTG
CCCAGCGACCCTGGGGGCGTGCTGGACTTCCTGGAGGAGGTGCACCATAAGCAGGAGAGC
ATCATGGATGCAGGGCCGGTCGTGGTGCACTGCAG
gtgacagctcctgctgcccctctaggccacagcctgtccctgtctcctagcgcccagggc
ttgcttttacctacccactcctagctctttaactgtaggaagaatttaatatctgtttga
ggcatagagcaactgcattgagggacattttgatcccaaggcatatttctcctagaccct

Exon 11 +      70912      70979   2   Internal     68    87        Good
gtttgggctgactccaaagccctatgctttttgccaacatattttcaaacataaatagac
aattttataaatagctccaaagagtagacattgtttctgttgatattaatggcttggttt
tgagtctgaaacccccatgaatgattctgttgtccctgctttttgtccttctgcccgcag
TGCTGGAATTGGCCGGACAGGGACGTTCATTGTGATTGATATTCTTATTGACATCATCAG
AGAGAAAG
gtgggtcatctggtgggcaagaagcgacagtttctgtttttagtttatggaaggaaagtg
ctcacgaaaacagtctggggaagagaggttgaatgggaaaattctttcacaaaaatctgg
gctgaagacttcagtgtgtctgcctgagaacagaagtgacactatttgagcttttggcat

Exon 12 +      71493      71644   1   Internal    152    89        Good
tagtcttctgggatcattggtattggtcagaagttcaacactgtagccattgcaacatgc
tcagttaaaacagcaaagactaaattagcattgtctctgagtccactaaaagttgtgcat
taaacaacttcatcctggctctgcagtttctctttattcttcatgatgtttccttcgtag
GTGTTGACTGCGATATTGACGTTCCCAAAACCATCCAGATGGTGCGGTCTCAGAGGTCAG
GGATGGTCCAGACAGAAGCACAGTACCGATTTATCTATATGGCGGTCCAGCATTATATTG
AAACACTACAGCGCAGGATTGAAGAAGAGCAG
gtaccagcctgagggctggcatgcggattctcattctcttgctaggcctcttggatacgc
tctccttttgagcaggaggacaggctctgatagacaactgtttgatttcggaatgggaaa
caaactcccaactaaaagggcctctggaaactgtcaattattctccacttctcagctctg

Exon 13 +      86249      86434   0   Terminal    186    59    Marginal
ttaaattgctctctgcaataatttgcaatggaactggaatgccagggttctgagtccttg
ccagacagctcgtccctcctgttggcatgactgagtcagctgtcatgattccctcagtac
cagtggcatgcctgtgacagacagcctgtctgcctttcattcccgtcgtctcccttgtag
GGTTCAGATCCAGGATACACTGGTCCTGGAGCCCCTCTCAGCCTGGCACCCACAGCTGCT
GGGTTCCTTACTCTCCTGGACTGCTCTGATGTCATCTCCCTGCTCAGCAGAAAGAAGTCT
GGGATCTTGATGCTTTGGCCCTCTGTCCTAGGCCCTAAACCACCCATTGCCCTTCACATA
ACCTGA
gctggggctaaatagatctctcatcactgcctgcctgctcctgtattttcccttcttgga
gcttttgcctgttcagatccctctactggaaattaataggatttcattctatgtgtgcat
ttccaacctttcttcacagtgcgatccaaatgcctcatcctacaggcctccttaaaacaa

Exon 14 +      87164      87233   2   Terminal     70    79        Good
attatattgctgtatggctatctcttctctccctgggaatgtcaggtcctaggcacagga
actgtgtctgtaccatatctggtgcccaaagaatgtagtatgtgttttatagatatcatg
taagcttaaacagcgtggtctacatttttgtaaatgtctttctttttcttttctctccag
AATGAGAGAAGACAGTGCTAGAGTCTATGAAAACGTGGGCCTGATGCAACAGCAGAAAAG
TTTCAGATGA
gaaaacctgccaaaacttcagcacagaaataggtatttaaatgcaagtgctctattggtt
aattgtttatataattggcagtatttttaagcaggcaagcaatttgggaatgttttagca
aagtgtaccataattgagttttacaaaccaggctcctttttcctctccctgtacttcttt

Exon 15 +      88294      88384   1   Internal     91    93   Excellent
aaactccatctcaaaaaaaaaaaaaaaaaaaaaaaaactcagtgtcagtatttcatgtcg
aaattccacttcaatgggtagtgtagttaaaagctctaagtctaccttaaaatcacctaa
tgctttgttaagcttttagatatatgttccttaaaaactcttaacttatttcttccccag
ATGTGGACTTTCACCCTCTCCCTAAAAAGATCAAGAACAGACGCAAGAAAGTTTATGTGA
AGACAGAATTTGGATTTGGAAGGCTTGCAAT
gtggttgactaccttttgataagcaaaatttgaaaccatttaaagaccactgtattttaa
ctcaacaatacctgcttcccaattactcatttcctcagataagaagaaatcatctctaca
atgtagacaacattatattttatagaatttgtttgaaattgaggaagcagttaaattgtg

--------------------------------------------------------------------------------