--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (32019 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (17 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1441       1554   0   Terminal    114    72        Good
ggcagcgggagaggaggagccgcaggagctgcagctctgccagcttgggccgagcctaga
gacaccggcctggctggtccacgccagccgcaggtgggaagggcctgggatggggggtga
gggtctctcggctggggctgaagctgagccgaggtgctgtctcctccttctgttccgtag
ACCGTGGCTGAGCATGGAGCTGTCCCCCCGCAGTCCTCCGGAGATGCTGGAGGAGTCGGA
TTGCCCGTCACCCCTGGAGCTGAAGTCAGCCCCCAGCAAGAAGATGTGGATTAA
gcttcggtctctgtaagtccccggcccgggaatggggggaagggaccttagggagcctga
gcgggaggaggaggggggataactggagcagggctgtgggctggtagattctctttggca
cagatgttggcaggtgcgaggaagcacggccctgacacgcgtggccaggccacatgtgca

Exon  2 +       3627       3760   1   Terminal    134    63    Marginal
ttagggtggacaaggatccctattcttattgattagatcattctggtcttcactcacttc
agcagtctggtccttaagaatgctagctttgtacaataaatttacaagtaaaaaataaag
ctagctacatgtaatataacttacccaaaaaagtacaatctccggattattaattggcag
GAATAGATTCCCAGTCTTACGTCCTTAAAGCAGAGAAAGACCTTGAAATCAAGGTAGATC
CCAACTTGATCTATGTTGATGGCCTACTGGATTTTGCCTTTTTGAATATTGGGGAGGCTT
TGACTATCAGATGA
agggaaataaaaggatttagggctttgctgggtaagaggtgggagtttcccaaccctctc
aatgggatggtttctgaataggtgagaaaggagatgttcccccttttaagtggaaataaa
gatccccctgcccctttggtcaaggtgggaaggggttgctaagtctggaaataggaaata

Exon  3 +      13902      14025   1   Internal    124    92   Excellent
acttatggtgatctttttgggaatgtgggtgctggaagcggaggcaggggactttggaaa
tccccagaacaccagccatggtgagccaaagaaatgaactgtagaagctggagaagctga
gctcttctgaggtgttggggttataactgccagagtcttttcctcccaatggctgcctag
AGCTAGGAGAGACTGTGGACTTCCAGAAGTTGGGATCTGAGGCTTTTCCAATCGTGCAGG
GACTGAAGGTAAAGCAGAAAGAAGTGGTGGTGGTGAAACGGGCAGGGATGGAGTTCGAAG
GAAA
gttgggggaagctgccagttttccttggggccagatgtggactggacggggttgagcatc
ctgttctacagggaaaggtacctttactgtgccagattccttgatggctgaaacagaggg
tttggattaaaactgatgttggtgggatagaaggacttcctgcagaagaacagtgaggtg

Exon  4 +      14470      14509   0   Internal     40    68    Marginal
gtgtgtgtggagtgggttatttgacttcaggaggttgcagttcagcaccttcaagagggt
gctttcagctgcttgagtccaggtcctcttcttagacttcccatttgtcaaatttattct
ttaatcttttttcccctccctccctgcctccttctggtgtctggattgtgtttggttcag
ATTTCAACAGAAGCTATACAAGAGCTCCTGGACAAGATCT
gtaagtgacagaaggagaaactcggagggaaacctgtgcttgaagtcaacctacaacctt
actcttctcaggctcactgttatttttagaaaccctggctcagaaatctccattgtgagc
tctgggagatagcctcacacctgattaattttcccctttccgttttatttatttaatgaa

Exon  5 +      18555      18668   2   Internal    114   100   Excellent
agtggcaatagcctgagattaaaaaagaaacattagctgctattattattaatgttagaa
tgattaactatttacaaaagactgaggatgtttctgtaaaatgtaccttattagggagta
tgctgttctcatgataaggtagctgtgcctaagcagcctctctgtatctgctccctgcag
GCTGCGCTACATGGTGAAGCAGTTGGAGAATGGGGAGATAAACATTGAGGAGCTGAAGAA
AAATCTGGAGTACACAGCTTCTCTGCTGGAAGCCGTCTACATAGATGAGACACG
gtgagagagaccgacagacagagaaggagaaagatgtcagacatagtgttccagagagag
gggttaagacaaagatagacacatgtggcatggacagagaccggaagaaagagagagggt
ggaccagatataaagagctctaggtagtggctcacacctgtaatcctagcactttggagg

Exon  6 +      20765      20939   2   Internal    175   100   Excellent
tttcattattggagatgttagataaagaaataaaaagatatagagaaagaaaggaaacag
ggttgaagacagagagctggcatgagagttactaaatgtggggtatggctgggtacaggg
tctctaggctgtggaagcacctgctgtctttcctctgtgactccccttctggggtctcag
GCAAATCTTGGACACGGAGGACGAGCTGCAGGAGCTGCGGTCAGATGCCGTGCCTTCGGA
GGTGCGGGACTGGCTGGCCTCCACCTTCACCCAGCAGGCCCGGGCCAAAGGCCGCCGAGC
AGAGGAGAAGCCCAAGTTCCGAAGCATTGTGCACGCTGTGCAGGCTGGGATCTTC
gtggaacggtgaggctcgcccacactcagcctccctctgcctttagctgtgcccctcttt
cccagccaccctggtcttccatgaccaccagccatatgatcccatggctcatccccacat
ccccagctggccacacctccactcccagaccttcatatgtgggcttcttctcattgttct

Exon  7 +      21005      21097   1   Internal     93    54    Marginal
ggtgcgggactggctggcctccaccttcacccagcaggcccgggccaaaggccgccgagc
agaggagaagcccaagttccgaagcattgtgcacgctgtgcaggctgggatcttcgtgga
acggtgaggctcgcccacactcagcctccctctgcctttagctgtgcccctctttcccag
CCACCCTGGTCTTCCATGACCACCAGCCATATGATCCCATGGCTCATCCCCACATCCCCA
GCTGGCCACACCTCCACTCCCAGACCTTCATAT
gtgggcttcttctcattgttctctctcaggatgttccggagaacatacacctctgtgggc
cccacttactctactgcggttctcaactgtctcaaggtaatctctgggtttttgggaaag
aggagaaagttaggggatggaatagccactgggacttctagaccctgtttatggcattat

Exon  8 +      21822      21938   0   Internal    117    92   Excellent
caaactcctgccttcctgtctctcccatactgagagatatatgggaagaaagaggcacac
tttaccatttctttgctttcctatttaccaagactttgtactcatgggaagtccttcttg
aagtctaacttcaacccttgctgctgctggaaagccacataatctattgtttctccatag
AACCTGGATCTCTGGTGCTTTGATGTCTTTTCCTTGAACCAGGCAGCAGATGACCATGCC
CTGAGGACCATTGTTTTTGAGTTGCTGACTCGGCATAACCTCATCAGCCGCTTCAAG
gttgggcagcatcctacctctacctccaggcaggattctccactcctctcatgcctgttc
taaaagcctcccaacaaacagattccatagatcccctcactcagtctcaacatcagggaa
gtctccccatgcccacgcccagcctagcctttctttcacttgctgcagtcttagttccag

Exon  9 +      24182      24322   0   Internal    141    97   Excellent
cccaaggttgcacagccagcaggtggtagaggcaggatatgagccaggttcacctaacta
ggttctgtgctctctccctatgccacactgccttctaaagaaagttgttgatctcggtcc
gtaatcaccaccattcctgtggatccttgatatatctccatttcccctaactccccgcag
ATTCCCACTGTGTTTTTGATGAGTTTCCTGGATGCCTTGGAGACAGGCTATGGGAAGTAC
AAGAATCCTTACCACAACCAGATCCACGCAGCCGATGTTACCCAGACAGTCCATTGCTTC
TTGCTCCGCACAGGGATGGTG
gtaggtgccctggagatgattcttctgtgattcagggcctatggctacagaactgggagg
tctagactgtactcccatttccatttctcctcgttggttcttcttgggcactccaaagcc
ttgacagagccaaactggattaactcactctagagaattcccaggtagactaaaactcgt

Exon 10 +      24729      24829   0   Internal    101   100   Excellent
ggttcggatggaggaaggtccttggccatttcaggagctgagaaacctggctgcattaac
caagagctggcctggaagcatggaagggatgggatgagtgatctagcctgtgtgtggagg
ttcctgggaagtgaccagcaggcgtcacccctctctcattctttctctttcctcctgtag
CACTGCCTGTCGGAGATTGAGCTCCTGGCCATCATCTTTGCTGCAGCTATCCATGATTAT
GAGCACACGGGCACTACCAACAGCTTCCACATCCAGACCAA
gtgaggggtggggatgtggcaggggcaggaggggccaagaggaggtggggaggttgccgg
agtccctccttacagggggtggtcatgatgacctttggctttgtaggtcagaatgtgcca
tcgtgtacaatgatcgttcagtgctggagaatcaccacatcagctctgttttccgattga

Exon 11 +      24936      25061   2   Internal    126   100   Excellent
gccatcatctttgctgcagctatccatgattatgagcacacgggcactaccaacagcttc
cacatccagaccaagtgaggggtggggatgtggcaggggcaggaggggccaagaggaggt
ggggaggttgccggagtccctccttacagggggtggtcatgatgacctttggctttgtag
GTCAGAATGTGCCATCGTGTACAATGATCGTTCAGTGCTGGAGAATCACCACATCAGCTC
TGTTTTCCGATTGATGCAGGATGATGAGATGAACATTTTCATCAACCTCACCAAGGATGA
GTTTGT
gtgagcagaagccagtacttggcatccctaagagactcccttaccacaaactccattttc
cacttcctggacctcctgcccagcagcgctgaggggactgattgcttctctttttatgtc
cgctcagagaactccgagccctggtcattgagatggtgttggccacagacatgtcctgcc

Exon 12 +      25189      25290   2   Internal    102    81        Good
atgcaggatgatgagatgaacattttcatcaacctcaccaaggatgagtttgtgtgagca
gaagccagtacttggcatccctaagagactcccttaccacaaactccattttccacttcc
tggacctcctgcccagcagcgctgaggggactgattgcttctctttttatgtccgctcag
AGAACTCCGAGCCCTGGTCATTGAGATGGTGTTGGCCACAGACATGTCCTGCCATTTCCA
GCAAGTGAAGACCATGAAGACAGCCTTGCAACAGCTGGAGAG
gtggcatctggtggggtgtggctggggccaggccagagggaggggtgtgtgaactggggg
ggtatacacaagggtagttggtgtgccaggtctttacctcgctgtagagactccactggc
ttcaggtatcagactgcatctctatgtgagagagagagagagtgtgtgtgtgtgtgtgtg

Exon 13 +      26679      26794   2   Internal    116    95   Excellent
tgagctgagattgtgccactgcactccagcccgggcaacagagtgagaccctgtctcaaa
aaaaaaaaaaaaaaaaggaagaagttatgtgatagggtgtgcgtgggaagttagggaatg
gtcctaacttccttttcctaaaagatcagtctcccttcccttgccatctgccccaaccag
GATTGACAAGCCCAAGGCCCTGTCTCTACTGCTCCATGCTGCTGACATCAGCCACCCAAC
CAAGCAGTGGTTGGTCCACAGCCGTTGGACCAAGGCCCTCATGGAGGAATTCTTCC
gtcaggtagcgtggcatctttgccttccctgtgcctatgggggccttctctccccttttg
ccctccaagttccccaatcctgttccacatcctccttttgctacctgtagtctctgacct
gatcccaaatccttggggtaaaaccccattatcctaaaagcctaacaatagttgcatttc

Exon 14 +      27573      27681   1   Internal    109   100   Excellent
tctctggggcaccaagacatcatcccaaagcctgccctgcattgggaagttttcagcccc
aggttacctctccatcctctttcataagcagccaggggtcctggccatgccagctgcatg
ctctgcctagccctccagataatagtaagacatctctacggcattgctcctccactgcag
GGTTCATCGACTTCATTGTGGAGCCCACATTCTCTGTGCTGACTGACGTGGCAGAGAAGA
GTGTTCAGCCCCTGGCGGATGAGGACTCCAAGTCTAAAAACCAGCCCAG
gtgagggtggctggggtagccagatatcttggttcaggaaggcagtggtagggagggatt
tggactcacagagaggaccgactcacagccatggtggggtggtggggaggcagactgctt
caagcttgggagtccctctgccgtcagggacagaaggatgggatcagaagggtgtgacct

Exon 15 +      28152      28282   2   Internal    131    95   Excellent
ggaggggtgaaatgagggggagagggacagggacttggggaatatctagtagaggaaaag
aggaagatgaagttccctgaaccttctcctggtcttccatgtcctgcactcccagggcta
aggtggttctggagtgggctggggcttacctcttgcggcttttgggggttctgcttctag
CTTTCAGTGGCGCCAGCCCTCTCTGGATGTGGAAGTGGGAGACCCCAACCCTGATGTGGT
CAGCTTTCGTTCCACCTGGGTCAAGCGCATTCAGGAGAATAAGCAGAAATGGAAGGAACG
GGCAGCAAGTG
gtgggtaccatggcagagggcaggggtgagaacttgtgtgggtggatcatggagcactag
gaggtccatttttcttaagcccctggggaaaccctttgccggactccttgatttgggagt
ggagctgatcagaccagttagatcacaggaaagactggctgagtggcctggaatgttcta

Exon 16 +      28806      28909   1   Terminal    104    94   Excellent
gagggttctgagttttagcaaggctggagaggctcttcccaagtggggatgggttgaatg
tagttcagcttgaaggcaggttgatggatgagaatcccttacatgtctccacatactcct
tgggttctggggaagaatacttcttggcctaagctcagcctcctttatgctcctctacag
GCATCACCAACCAGATGTCCATTGACGAGCTGTCCCCCTGTGAAGAAGAGGCCCCCCCAT
CCCCTGCCGAAGATGAACACAACCAGAATGGGAATCTGGATTAG
ccctggggctggcccaggtgagcctgttgtggtggagggtgtaggagagctggtgtctat
catggcatctttgttgggtcgtctctgggctccagtggatgcgacattctctctcccctt
ttgagcagtaaaatggagcgagtgaagacatagaatggagccaaagtgtgggtggagcag

Exon 17 +      29441      29569   0   Internal    129    95   Excellent
gcagctgaacgtgacttcgacttcagcccctattcacccccttggctgggcacccttctg
aagggcattttttgcacagctctactcgggactgagtggggatcaggacttggagaagga
aggtcaggttggaggtgaaggcaaagctcagggcactgaagtttctccctctttccccag
GTCTTCATTGAGTCCAAAGTGTTTGATGTCATCAGCACCATCCATCAGGACTGGCTCCCC
CATCTGCTCCAAGGGAGCGTGGTCGTGGAAGAAACAACCCACCTGAAGGCCAAATGCCAG
AGATTTGGG
gttggggaaagggcccctccccacctgacacccactggggtgcactttaatgttccggca
gcaagactggggaacttcaggctcccagtggtcactgtgcccatccctcagcctctggat
tctcttcatggccaggtggctgccagggagcggggagcttcctggaggcttcccagggcc

--------------------------------------------------------------------------------