--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (135353 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (27 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1172       1284   0    Initial    113    70        Good
gtcgggggcgtcggtcggggcgcgggggaccccccccccgggcggcagcggcagcggcga
tccgatcccgcgggctgcgccgcccgggctgtcaagcgcggggggcgggcgggaggaagg
ggtggaggtgcgaggggaggagggctggcaccggagcgccgcggcgtcggtgcaataaaa
ATGCATCGCATGGAACTGCCCGTGGAGAAGGACGGGACGGAGCCGGGGCAGCCAGAAGAG
GTGGGAAAAGCGGAGGAGGACGCCCAGGAGGAGGCGGCGGCGGCGGCCGGGAA
gtgaaaggtctcgcaaagttcagcggcggctgcgggcgccgagccccgggctagcggcag
acgagcccgcagggccgctccgcggggcagcgcagccaggccggctatggtcccggggct
cccgccgccccccaggtgcccgggacccgccaggccggtgcgcgagggtcaccccacctc

Exon  2 +       4469       5038   0     Single    570    73        Good
cacacgcatacacgaatgcattgtgaatgcagaacagtgttcatgctcaaacaggaacat
ggtggagcatggtagaatttgccatttatcgaaagtctcaagcgcttttggggagatcct
tgactgttgttgatggactaggtggccaaaagagctttccagatgggtttgtcttgcatc
ATGCATGCTTTCCCTTTCTTAGGACTGAGTGGAGTAGCTGGAGTGAGTTCCCGCTGTGAA
AAAGCCTGCAACCCTCGGATGGGAAATTTGGCTTTGGGGCGAAAACTCTGGGCAGACACC
ACCTGCGGTCAGAATGCTACCGAACTGTACTGCTTCTACAGTGAGAACACGGATCTGACT
TGTCGGCAGCCCAAATGTGACAAGTGCAATGCTGCCTATCCTCACCTGGCTCACCTGCCA
TCTGCCATGGCAGACTCATCCTTCCGGTTTCCTCGCACATGGTGGCAGTCTGCGGAGGAT
GTGCACAGAGAAAAGATCCAGTTAGACCTGGAAGCTGAATTCTACTTCACTCACCTAATT
GTGATGTTCAAGTCCCCCAGGCCGGCTGCCATGGTGCTGGACCGCTCCCAGGACTTTGGG
AAAACATGGAAGCCTTATAAGTACTTTGCGACTAACTGCTCCGCTACATTTGGCCTGGAA
GATGATGTTGTCAAGAAGGGCGCTATTTGTACTTCTAAATACTCCAGTCCTTTTCCATGC
ACTGGAGGAGAGGTAAGGGCACCTGTTTAA
ctctacactgtaagtaagatagaaaaatgttaccagcccgcatttttttttaaagcatga
agctatacttgtagcaacatgaatgaaattagaatttttcatgagatttatttgtcataa
attatttcttacccttacatatgaatgtgtagtcattttcaagcagattgcccactggct

Exon  3 +       6356       6444   0    Initial     89    90   Excellent
tcctttatataactattctcagacttcccaggtagttgtgtataatcagcatgtattgac
cccctcaggcactgtattcaacgctactaattctgcttttggtgtggtatggggaggtgc
ttgccaggggcctgatgaaaaggttggtttggggcctcctttccccacttccatagatac
ATGGAGACTTTTGCCATGTCATTCAGCCGCTTCTTCTGTGTGCACCTTGAAGAGACCAGC
AAGAATAGTGCTGCTGGCACCAGAACCAA
gtaggacatggtgcaagcagcacactgactgttttccattcttcatggtccccaaagttg
gctgaatattgtaagcccatttgcaacctgtcatgatggacatttttaaagataccacga
caggaaagagacagataagttagtctcattgttttgttatgtggagaacactttgtgctg

Exon  4 +      10501      10592   1   Terminal     92    83        Good
agcttaacaacttttttcttccaacttttaagtgcaggggtacatgtgcagcatgtgcag
gtttgttgcataggtaaatgtgtgccatattggtttgctgcacagatcatcctattgccc
aggtattaagcccagcatccattagctattcttcctgatgctcgccctcctcccacccag
GTTTGCTATTTTTAAAACAGATTGAAGGATTTGTGTTTGATAGAATGGACAGTGACAAGG
ACTATGAGTTCCTGGCAAGTTTTCATGAGTGA
acaaaacctataattaagggtcacatttgctttatggtaatggtatggttttttaaattt
ttttattatactttaagttctagggtacatgtgcacaacgtgcaggtttgttacatatgt
atacatgtgccatgctggtgtgctgcacccattaactcgtcatttacataaggtatatct

Exon  5 +      15417      15436   1   Terminal     20    82        Good
cctggttccattctccccatcactttcaggcacaccaatcagatgtagatttgatctttt
cacatagtcccatatttcttggaggctttgttcgtttcttttaattcctttttctctaaa
cttctcttctcgcttcatttcactcatttgatcttcaatcactgatatcctttcttccag
TTGATCGAATCGGCTACTGA
agcttatgcatgtgtcacgtagttctcatgccacggttttcagctccatcaggtcattta
aggacttctctacattggttattctagttagccattcgtctaatctttttccaaggtttt
taacttctttgcgatgggttcgaacttcctcctttagctcggagaagtttggtcgtctga

Exon  6 +      15968      16023   0    Initial     56    42    Marginal
gatggtgatgtacagatggggttttggtgtggatgtcctttctgtttgttagctttcctt
ctaacagtcaggaccctcagctgcaggtctgttggagtttgctggaggtctactccagac
cctgtttgcctgggtgtcagcagcggaggctacagaacagcgaatattgctgaacagcaa
ATGTTGCTGCCCGATCGTTCCTCTGGAAGTTTTGTCTCAGAGGAGTACCCGGCCGT
gtgagttgtcagtctgcccctactggggggtgcctcccagttaggctactcaggaggcag
gctgtccattctcagatctcaaactccgtgctgggagaaccactactctcttcaaagctg
tcagacagggacatttaagtctgcagaggtttctgctgccttttattcggctatgccctg

Exon  7 +      19136      19257   0    Initial    122    41    Marginal
aaaaaagaaaaaaaaaagccattggagattttgagattttaagtggtggggtgatattat
ctatttttagtacgattactctggcttgtgtgttaataaaagaccaaagagggaaggagg
gtgagggaagaggcagggggaccatttagaatcctattgcaataattcagactagacttg
ATGGTGCATGGGACAGAGGACAGAGGTAGAAATGGTGAAAAGTGGTTGAATTCTAGATCT
ATTTTGTTGATAGAGCCAACAGCATTTGCTGACAGTTTGGATGTAGACTGTAAGAGAAAG
AA
gtaagtatgtttttagtttgagcacctggaagaatgcaacgaccatttactgagatagag
aagatgtgccagggaacagatttggagaagaagaccaggaactcattttcagacacgtta
agtatgagttgccttttagacatacaaatggagatacgtaggaggccactggagtttaga

Exon  8 +      19291      19378   0    Initial     88    46    Marginal
attgcaataattcagactagacttgatggtgcatgggacagaggacagaggtagaaatgg
tgaaaagtggttgaattctagatctattttgttgatagagccaacagcatttgctgacag
tttggatgtagactgtaagagaaagaagtaagtatgtttttagtttgagcacctggaaga
ATGCAACGACCATTTACTGAGATAGAGAAGATGTGCCAGGGAACAGATTTGGAGAAGAAG
ACCAGGAACTCATTTTCAGACACGTTAA
gtatgagttgccttttagacatacaaatggagatacgtaggaggccactggagtttagag
ttcagaaaagctggctggaccaaacatatgtgtgagattttaagctatgaagctggatga
gattgccaagggagtgagtatggattaaaaaaagagaaagttctaaaaactgagccaagg

Exon  9 +      48412      48516   0    Initial    105    86        Good
atgtaaaaggattcatatcatacaaaatatgttctttgaccacaatgaaattaagttaga
aatcaataacaggaaggtatctgggaaatccccaaataactggagtaaacacacttttta
ttccagttattcaaagaagaaatcaaaaggaaatcaggagtattttgaaattgaatggaa
ATGAAAACACAGCGTATCAAACTTCGGGGGGATGCAACTGAAGAAGTACCTAGGGAAAAA
GAAACATCTCAAATCAATGATCTTCAAGTCCAACAGAGCTTAAAA
gtaaaattcactgcttagtgaattatttttaaaaagtcaaatcaatgatctaagttttcc
ctttaagaaactagtaaaagaagagcacattaaacacaaagtaagcagaagaaagtaaat
aataaagataaaagcagaaaccaatgaaaaagaaaaacagaaaaacaatagagaaaatca

Exon 10 +      49125      49231   1   Internal    107    66    Marginal
attacatatttttacatagtgtttatacatagatgtgtgtgttcacatcgttctcatcaa
gagtgcggaacttgtggtaagagcatcttgctatctgtgttcttctaaactctagaccct
gtttggcttctcctcttagaatgatacttggagaaatagttgattcatttattcattcag
CAGTCATTATGAAATGCTACAATGTGCCAGAGACTGTGGGACATGCTGGGGAGCACAGCT
GTGAACCAGACAAACAGGATCCCTGCCCTCTGAGCACTGAGTCTGAT
gtgagatacagacaagtaaataggcaacaacaatagaacagtgtaagtgtgccatcatgg
aaggaacgagttccaagggagtccacaggacggccttgaatattattcctcaagctagca
gctaaaaagaatttttaaaaatatgatcacatttattattacaaatttttataattcaac

Exon 11 +      49827      49974   1   Internal    148    56    Marginal
catgttaaccaggctggtctcaaactcctgacattgtgatccacccacctcagcctccca
aagtgctgggatgacaggcatgagccaccgcacctagcctaattttccatcttcttattg
agaattttttatgagtattctagaatagaaagatcatataggtcattttcacctgttcag
GACTTTGTATGGATTTCTCTGTTACACTGGGGCACAAAGAAATGGCAGAGCCTGAGCCAA
GAATCCCCATCCTCAGGCAAAGTTCAAGGGATTCGAGGCTTAGAGAAATAAGGCAAGACC
AGGAAAATGTGAAGATTCCAAAGGTTAG
gtaggaaggggtccatgattcattcagagggtcagatattttttaaattatgcatttcct
ttacccattgatttcagctttggaaatgtatcttcaggaaattattacagtagtcctccc
ttatgtgcagtttcacttaccgtggtttcagtaaccatcaaccatggtccaaaaataggc

Exon 12 +      51654      51758   2   Internal    105    58    Marginal
actttctaaatattaatatatcttgttgggagtgtgtattaagaggcagttgtagacaga
ggatcagtgatgggcctatagatacattcccttccttatgggaacaaaacacagaagagg
ctgatactatcctgagggcttctacgtgttttcttacttcatttcactcatgccatacag
GCTTCTTCTGGGGAAGTTTGAAGAAAAACTGGGTGGGACCCAAAGGGCGACCTGCCAGAA
GTTGGAAGCATCTGTACTGGCGGACTCTTTGTTTCCTGACGCAGG
gtagatccattcccagggtatcagattaaggcgtctcctttctggaaaaaagatttcatg
gtttaaattcccgttcacttttgtgtctgtggcactctgctgtctcctttccagcacaca
gcctcaggggtcatgatgtcccttccctactgatatccgcgtgccaactgtggtgtcatg

Exon 13 +      51986      52063   1   Internal     78    56    Marginal
aaaagatttcatggtttaaattcccgttcacttttgtgtctgtggcactctgctgtctcc
tttccagcacacagcctcaggggtcatgatgtcccttccctactgatatccgcgtgccaa
ctgtggtgtcatgcacaccaagcacagagccgccattcagctcccactgtctgggctcag
GAAGCAGAAGAGCTTCAAAGTTCCTACAGACCTTGACAGAGCTTCCTCTGGCTTTGCCTG
TGCGGAACAATTCTGAGG
gtgagggggagatggaatggggtgagagagggaactagggtaaatgtcaagggtaaatac
gtggcagagacagagagagaccaaacagttgccaccgaggctcaggaaaaggaagggtgg
gcagataacgaggagaaggacaccacagacttttcagtggagctcttacttggttagcac

Exon 14 +      53815      54106   0   Internal    292    89        Good
tctgctccttagaataacagggcggctctgtcccaggtgtgctcaaggtctaaaaacttc
ttgttatcttatcgttcacagatgacataaggcataaatcaaacagggactacattaggc
aaacaattcagggtttgcgcacagtcctataaacgcatggtattttctttctccttacag
GTTATTTTCAAAGCTTTGTCACCACCATACGATACAGAGAACCCTTACAGTGCCAAAGTT
CAGGAGCAGCTGAAGATCACCAACCTTCGCGTGCAGCTGCTGAAACGACAGTCTTGTCCC
TGTCAGAGAAATGACCTGAACGAAGAGCCTCAACATTTTACACACTATGCAATCTATGAT
TTCATTGTCAAGGGCAGCTGCTTCTGCAATGGCCACGCTGATCAATGCATACCTGTTCAT
GGCTTCAGACCTGTCAAGGCCCCAGGAACATTCCACATGGTAGGTGAAACAA
gtcctcccctaagaaaaacaaatcataagttaccttcagctttgggcattggttggtata
tgcttaacatagtgctgctgattttttcctctgcccatcacagctccgactccatactca
tcctataaagtgcctgttaacttgtcttttaatcttcagttttagagttgtagtcaagcc

Exon 15 +      54647      54718   1   Internal     72    86        Good
ataagaacctcgattttatgcctggtatctttgctgtccagccagcagaatgaataaaaa
ttctcctccatgaagaggactgaccccctcttcacctaaggcagagttaaactctctttc
ctctaggttcacacatctcctgggctttcctctgaatttttacttctctgcatcccccag
GAGACCACGAACTCTCTGAGGAACTGTATGATCTTTGTATCCTCAGGACCAAGTGTATTA
CCTGGGCCAGAA
gtaggtgctcagtaggtgtttggttgaatgatagcaacataggaatagggagatgatgaa
aaattagtgtcattgtttatctgtccttacctccccgacttccagaaaagatacagagtg
gctcagcagtaagcaccttgttgggacacatccagagactatggatggggattgggcaag

Exon 16 +      62918      63031   2   Internal    114    67    Marginal
tattttatatataatataaacattatgcacttcatacaagtaaacatgaatcaagtgtct
tgccttttaattttgcatctctaagggcatgtattagtctgttcttgcactgctgtaaag
aaatacctgagactgggtaacttataagaaaggaggtttaattggctcatggttctgcag
GCTGTACAGGAAGCATGGCAGCATCTGCTTCTGGGGAGGCCTCAGGAAGCTTCCAATCAT
GGCGGAAGACAAAGCAGGAGCAAGACCCCTGACATGGCAGGAGCAGCAGCAAGG
gtaggggaggttccacacacttttaaacaaccagatcacttgagaactcactatcctgag
ggcagtgccaaggggaatggtgctaaaccattcctgagaaacagcccccatgatccaatc
gcctcccaccaggccccacctccaacactggggattacagtttgacatgagatttggatg

Exon 17 +      81330      81526   1   Terminal    197   100   Excellent
ctggtctcaaactcctggcctcaggtgatccacctgcctcagcctcccacaagtgctggg
attacaggtgtgagctaccacgcctggccaactcatcctatttttacctatctgaatatg
agataacccatcattttatttttacttattagtgtttctctccacgcttcttatttccag
CCTGCAAGTGTAATGGGCATGCTGATACCTGTCACTTCGACGTTAATGTGTGGGAGGCAT
CAGGGAATCGTAGTGGTGGTGTCTGTGATGACTGTCAGCACAACACAGAAGGACAGTATT
GCCAGAGGTGCAAGCCAGGCTTCTATCGTGACCTGCGGAGACCCTTCTCAGCTCCAGATG
CTTGCAAACGTAAGTAA
cctgtggtttccagaaaataggctgatttgtacaagagatgaatctctttatccctcatt
ctgctaacccaaaagaaggaggtcattgaggttctgagataacacactcacagatatcgg
ttaatttcttcattgataagaggcaagaattttcaaccagttgggtgaaaacagtataat

Exon 18 +      93410      93500   0    Initial     91    60    Marginal
gcatgtgccatcatgcccagctaattttttaattttttatttttagtatagacagggtct
cactatgttccccaggctggtcttgaactcctgagctcaagtgatcctcccaccttggcc
tcctaaagtgctgggattacaggctggagccactacacccagccaaaactttacaaattg
ATGGATAATAAAAATCAGTCACATTTGGGAAGAGAAGTGGACAAGGTCATGAAATTCTCT
AAAATGTCTTCCAAGAAGAAAGTGGAATGCA
gtaattcactgaataaataaatagtataccattctacttttgatgaggacatgtaataat
caagcaaacaattagaaaatatcaaaatcttcagaaggtctggacaaaattagaaggtgc
ataaagaagagaatgagcatttggtgaatggctgtcatggaccagacctcgtggtaggta

Exon 19 +      93614      93673   0   Internal     60    50    Marginal
ttgggaagagaagtggacaaggtcatgaaattctctaaaatgtcttccaagaagaaagtg
gaatgcagtaattcactgaataaataaatagtataccattctacttttgatgaggacatg
taataatcaagcaaacaattagaaaatatcaaaatcttcagaaggtctggacaaaattag
AAGGTGCATAAAGAAGAGAATGAGCATTTGGTGAATGGCTGTCATGGACCAGACCTCGTG

gtaggtaatttagcaatgtttatgtgctaagttatagctttatgtgctatattttctatt
ttacaaatgaagacactgagacttaaattgattacagttgtccctgttcctccatccaca
gtatcctcgagggattggttccaggatccccgaggataccaaaattcatggatgctcaag

Exon 20 +      94051      94095   0   Terminal     45    70        Good
cttagtattttcatataacctatgcacacccccctgtatactgtaaatcatctctaggtt
acttataatacctaatacaatgtaaatgctgtgtaaatagttgttatactgtagtgttta
gttgtattgttgtattgctattttttactgggtttctcctcaaatatttttgatccacag
TGGGTTGATTCTATGGATGCTGAATCCACGGATGTTGAGGGATGA
ctgtatataatttgcccatgttcacatagctggtcagtgccaaggctgggatttgaaccc
aggttagtctgactacaaagatcccatgacctgcaaagatccaaagaactgtattacaca
ccgtgacccagttaatgacaacagaatcaaaacccaaaggaagaaataataaaatatata

Exon 21 +     104125     104238   0     Single    114    40        Poor
ttaccatccgacctgactctacagcttttcttctgcctcatctccttcaactgctttcta
ctcagtgtacactcaggcacactaaacttctcacattccccacatgggctctttcacata
ggattcccacagcctggaatatcctccaggtcaattccacagatgctgattagggcatct
ATGATGTACCAGACACTGTTCTGGGGCCCCAAAGACAAAAATAAGAAGATAAAGATCCTT
CTGTCAATGAATTCAGACTCTACTAGTAAGAGAGATAGGCATATCAACAAATAA
ttattttaagaaactgtttagtggctgggcgtggtggctcacatctgtaattccagcact
ttgggaggctgactcaggcagatcacttgacgtcaggagttcgagaccagcctggccaac
atggtgaaactccatctctattaaaaatacaaaaaaatagccggtatggtggtaggcacc

Exon 22 +     107749     107919   0     Single    171    44    Marginal
caagaagttgaggctgcagtgagccatggtggtaccactgcactctggtcttggtgatag
agtgagaccctctctcaaaaaaaaaagcaaagctcctcaaaagagctatctgttcacatg
ctcaaattcctctactcccatactcccctgaatcctcttccactgggtttccctctcact
ATGTATTACACTGAAACTCTTCCTGTGAAGAACACCATCAGCTTTTGTGCTGTTCAAATG
CAATACTCCATCACATGCCCCATCTTCTTTGACCTTTCAACATCTGCCACAGCTGATGCT
GCCCTACTCCTTGAAACCTTCTTTGGCTTCCAGAACACTATACTCTCATGA
cgtcttttcctttctcactgaatccttccaccctgtcttctttgctggttcgtcctcatc
accccaaccaaagggcattcatatttcatgccttccatattaggataaattatgtgttta
tttttgcagcagacatgcttttctgattatatctcgcttatctgtcatttaattagcttt

Exon 23 +     108372     108463   0    Initial     92    82        Good
tgttcacacgggtgatctacagtcagtctttgatccttgcgtgtcctctctgttgtagcg
tgttcctgccatccagtaggatcagctgtccttcctgccaactcagtgaccttctgcgac
cccagcaatggtgactgcccttgcaagcctggggtggcagggcgacgttgtgacaggtgc
ATGGTGGGATACTGGGGCTTCGGAGACTATGGCTGTCGACCATGTGACTGTGCGGGGAGC
TGTGACCCTATCACCGGAGACTGCATCAGCAG
gtgaatgtgcaaggctcttgctctcagctgcatgtatttcaggctcttttgaaaacctat
agtgatttggaaaatcttgcattctgttaatggagcaaagatgtatttgcacatctcttt
taaagaatttttgtcaggctgggcgtggtggctcacgcctgtaattccaacactttggga

Exon 24 +     112060     112207   2   Internal    148    78        Good
agatatgttttagagggacatacttttaaataaggtgatcagggtaagccctttgaaagg
tgacatttgaggggaaaaaaattctgaaggaggtaagaaggctagctatacaggtggcag
agaaaagagagtttaggcagaagatacagcaagtctttaaagccctgaggaggaattcag
GAAACAGCAAGAAGGCCAGTGTGGCTGGAACAGAGTAAGCTGGGAAGACAAGTGGAAGAG
GAAATATAACGAGGCTGCAGAGGCCACTATGAGGACCTTGGCTTTCACCTGGAGTAAGAT
GGAAGCCATTGGAGCATTTCAAGCAAAG
gtgtggcatttagagtaacacccatcagcatggttgtgtgttttccctagtcacattcag
cactgtggatgtaggcatacacaaagagatgactttaagctgggttgaggtttttccaag
caagaatgaagcaagagagggcaataattgttcatagaatttaaactgggtaaataggga

Exon 25 +     121815     121912   1   Terminal     98    53    Marginal
tttagaaagagactctacttcttttgaatgactttcgtggttccttggtacttacagatt
acactgtatgcatcactcaaggcttaagggatgtgttatctggatacacttgctgatctc
ttattttttctttctttgcttttctaataactaacaccatttttaatttactttccatag
GTAAATGCGAATGTAAGGAACAGACATTAGGAAATGCCAAGGCATTCTGTGGAATGAAAT
ATTCATATGGTGAGTCTGAAATCCTTGAATGCTTCTGA
gaacctattcacactaagttcagagaatttttaagaaaatgggaggcctgactgatgaca
ttgtgtataaatgaaagcacaaagcattagtcttacataataacactaaacacagtgttc
tggtcttgagctagattttcctgatgtagttggtgatggatgtcccagggaggacagaat

Exon 26 +     126005     126151   1   Internal    147    70        Good
tccatccaagttaatgcctaatgatttttaaagcaaattttcacatcctcatcatcaatt
cacctttccattatattctgaaatgcatacttgagtgttattcaaacttcaaatgataat
atgaaattctatgcattttgacttctgtgttaacagtgctaaaaataaagattttatcag
CTCATGATAAAGGTACTCATGTTGAGGTCAATGTGAAGATTAAAAAGGTCTTAAAATCTA
CCAAACTGAAGATTTTCCGAGGAAAGCGAACATTATATCCAGAATCATGGACGGACAGAG
GATGCACTTGTCCAATCCTCAATCCTG
gtgagtattagactttcctatcttagtacctaccttgtctctgctgatttgctgcttgtc
ttacatcctctgaagcacaacataaacaaactcagcaagaacatctctccctttcaccat
ctgactcctgcggaaaatccaaatggaattctttgaactaacatcgaaaaattatttctc

Exon 27 +     132739     132875   1   Terminal    137    50    Marginal
gattacctaaacccaggagattgaggctgcagtgagccaggattatgccactacactcca
gcctgggtaacagagcaagaccttgtctcaaaataaatgcaaaagaaaacctgctggagt
cacatctctcccttcaacaaagtatgatactgtatagcccctaattttgttcttttttag
GTTTGGAATACCTTGTAGCAGGACATGAGGATATAAGAACAGGCAAACTAATTGTGAATA
TGAAAAGCTTTGTCCAGCACTGGAAACCTTCTCTTGGAAGAAAAGTCATGGATATTTTAA
AAAGAGAGTGCAAGTAG
cattaagatggatagcacataatggcacttgtctatgtacaaaacacaaactttagagca
agaagacctcagacaggaaactggaattttttaaagtgccaaaacatatagaaatgtttg
aatgcatgggtcttatctaacttatctcttctggacccatgtttaaatacagttttattt

--------------------------------------------------------------------------------