--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (8282 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1364       1918   0    Initial    555    92   Excellent
acttaatcattcacagctcgacagctctctcgcccagcccagttctggaagggataaaaa
gggggcatcaccgttcctgggtaacagagccaccttctgcgtcctgctgagctctgttct
ctccagcacctcccaacccactagtgcctggttctcttgctccaccaggaacaagccacc
ATGTCTCGCCAGTCAAGTGTGTCCTTCCGGAGCGGGGGCAGTCGTAGCTTCAGCACCGCC
TCTGCCATCACCCCGTCTGTCTCCCGCACCAGCTTCACCTCCGTGTCCCGGTCCGGGGGT
GGCGGTGGTGGTGGCTTCGGCAGGGTCAGCCTTGCGGGTGCTTGTGGAGTGGGTGGCTAT
GGCAGCCGGAGCCTCTACAACCTGGGGGGCTCCAAGAGGATATCCATCAGCACTAGTGGT
GGCAGCTTCAGGAACCGGTTTGGTGCTGGTGCTGGAGGCGGCTATGGCTTTGGAGGTGGT
GCCGGTAGTGGATTTGGTTTCGGCGGTGGAGCTGGTGGTGGCTTTGGGCTCGGTGGCGGA
GCTGGCTTTGGAGGTGGCTTCGGTGGCCCTGGCTTTCCTGTCTGCCCTCCTGGAGGTATC
CAAGAGGTCACTGTCAACCAGAGTCTCCTGACTCCCCTCAACCTGCAAATCGACCCCAGC
ATCCAGAGGGTGAGGACCGAGGAGCGCGAGCAGATCAAGACCCTCAACAATAAGTTTGCC
TCCTTCATCGACAAG
gtgagctacgatcttttgtaaaaaatcactgtgggtctgaaataaatgccaaagagagag
aaagaaggaagatgttttggctttgtgcaaatacttttatagttgtacagttctgtgttt
ccgtttgtttctgtgccctggatttgtggacacgttctgaattagactggcagctgggaa

Exon  2 +       2500       2714   0   Internal    215   100   Excellent
ctccccctggaaaagtgagtttgggtgcctcagtctgcacctcccctcctggggcccagg
gccaggcacagtgcacagaaaagctttagagggacggaaagaggtgggaggcaccttagt
gagttgatcatagaacatgaaatccaagtttctctatcttcaaaccctgctcccctccag
GTGCGGTTCCTGGAGCAGCAGAACAAGGTTCTGGACACCAAGTGGACCCTGCTGCAGGAG
CAGGGCACCAAGACTGTGAGGCAGAACCTGGAGCCGTTGTTCGAGCAGTACATCAACAAC
CTCAGGAGGCAGCTGGACAGCATCGTGGGGGAACGGGGCCGCCTGGACTCAGAGCTGAGA
AACATGCAGGACCTGGTGGAAGACTTCAAGAACAA
gtgagttggggtggagggtggacacaggggagggtggtgtcttcttggtaccagatgggc
tttgttactagtctactaccatgccttcctttggggctgggaggatataccttccatgga
cacctccagtactaaaacaaacaaacaaatacacaagccaggctcatgtttagaaagttc

Exon  3 +       2880       2989   0    Initial    110    66    Marginal
agacttcaagaacaagtgagttggggtggagggtggacacaggggagggtggtgtcttct
tggtaccagatgggctttgttactagtctactaccatgccttcctttggggctgggagga
tataccttccatggacacctccagtactaaaacaaacaaacaaatacacaagccaggctc
ATGTTTAGAAAGTTCCAGCCCCAGGCTCAGGCCCTCTGCAAGGAACTTAGTCAACAGCCA
GAGCAACATGCTCTGTGCCCTTGGCACTACCTGGTGAAATCTGCCCTGAT
gtaaggcttgctctctgggactttcctccccggtacatgggcctttggatagatttgtct
caaagcaggagctggtgacataacccagcttggtggctcaagtaatttctttagtcttat
gaaccagcaactaggatgctagatttaattttgtttcttttctttttttttttaaagcct

Exon  4 +       3497       3557   2   Internal     61   100   Excellent
agtatttaaatggggagggaccttggccagaggttcatgctaccagtgtcccctccctct
ctgcctatgaggagaagccccttcccactgcaaaagtaggcttacagttgactgcataat
aaagaccccttacctgttgctcatcctctgacaaacacttcccatccctttcaccaccag
GTATGAGGATGAAATCAACAAGCGTACCACTGCTGAGAATGAGTTTGTGATGCTGAAGAA
G
gtgcgtgtgggtgggagagaaccagcagcctgcagctatgctctctaagcgtggagctca
cttgagtagggtgacggtgtgtgcagtgccaatcatccctgtttccccaggatgtagatg
ctgcctacatgaacaaggtggagctggaggccaaggttgatgcactgatggatgagatta

Exon  5 +       3668       3797   0   Internal    130   100   Excellent
caccaccaggtatgaggatgaaatcaacaagcgtaccactgctgagaatgagtttgtgat
gctgaagaaggtgcgtgtgggtgggagagaaccagcagcctgcagctatgctctctaagc
gtggagctcacttgagtagggtgacggtgtgtgcagtgccaatcatccctgtttccccag
GATGTAGATGCTGCCTACATGAACAAGGTGGAGCTGGAGGCCAAGGTTGATGCACTGATG
GATGAGATTAACTTCATGAAGATGTTCTTTGATGCGGTAAGAAACTTATCTAAATTTTTC
ACATGGGTGG
gttttttttcctcaagttgtcatatcacaatgagtgaaagatttgaatggaactgacatt
aaataacacaacacagaaccagatgaccgactccaaatctccctgcaggagctgtcccag
atgcagacgcatgtctctgacacctcagtggtcctctccatggacaacaaccgcaacctg

Exon  6 +       3874       4088   1   Internal    215   100   Excellent
ggtggagctggaggccaaggttgatgcactgatggatgagattaacttcatgaagatgtt
ctttgatgcggtaagaaacttatctaaatttttcacatgggtgggttttttttcctcaag
ttgtcatatcacaatgagtgaaagatttgaatggaactgacattaaataacacaacacag
AACCAGATGACCGACTCCAAATCTCCCTGCAGGAGCTGTCCCAGATGCAGACGCATGTCT
CTGACACCTCAGTGGTCCTCTCCATGGACAACAACCGCAACCTGGACCTGGATAGCATCA
TCGCTGAGGTCAAGGCCCAGTATGAGGAGATTGCCAACCGCAGCCGGACAGAAGCCGAGT
CCTGGTATCAGACCAAGGTGGGTGCTCTGATGACT
gtctcctgagtgaggggacacacccatgtctaggattctaggccatgacgacactaagaa
tggggctcctggaacctgctgaagcccattgggatgctttataggaatggctgtgtagac
aatttccatctaaacccaaggacctgagaaataatctcactctgaatctcacaccagtgt

Exon  7 +       4428       4553   0   Internal    126   100   Excellent
ctctgaatctcacaccagtgtctccaggagagcaaaggcactagactagctcagccttgg
aaaagcctgaaccagccccacactatttgccaccacttagtactcactgcctgtgaactt
tgggaaagttcttcccattctcatataaacagaatctttcctctttcctggctgcatcag
TATGAGGAGCTGCAGCAGACAGCTGGCCGGCATGGCGATGACCTCCGCAACACCAAGCAT
GAGATCTCTGAGATGAACCGGATGATCCAGAGGCTGAGAGCCGAGATTGACAATGTCAAG
AAACAG
gtagggtgagattgaaagagggcaaggaaggggcctgagttctaaaagaaacacctactt
tgttttattttgttttacttttgctaaacacacgcagctagatccagtaccagtgtttca
gtgtcctgccacccacgatgtactggtttctctctgggattcatgatagtttggtttgtc

Exon  8 +       4803       5023   0   Internal    221   100   Excellent
ttgttttacttttgctaaacacacgcagctagatccagtaccagtgtttcagtgtcctgc
cacccacgatgtactggtttctctctgggattcatgatagtttggtttgtctgacccaga
aactcagaaggagacacctcaggtcccaagcaaccccactctcctcctttctatctgtag
TGCGCCAATCTGCAGAACGCCATTGCGGATGCCGAGCAGCGTGGGGAGCTGGCCCTCAAG
GATGCCAGGAACAAGCTGGCCGAGCTGGAGGAGGCCCTGCAGAAGGCCAAGCAGGACATG
GCCCGGCTGCTGCGTGAGTACCAGGAGCTCATGAACACCAAGCTGGCCCTGGACGTGGAG
ATCGCCACTTACCGCAAGCTGCTGGAGGGCGAGGAATGCAG
gtgagtagacagcatgaactcaagatggccttcagctgataaagcgaagctgctctactg
tggggtgtacaacacacatacatgagatcagtgacttgtgcgtgataatgacacatcatc
aacactatttcagtctgactcatggccatatagctgacctcaactcacttttctggtctc

Exon  9 +       5828       5862   2   Internal     35    74        Good
ccctcttcattggaaaatccctctggagagttctcccttcctttaacttaagcagctttt
gggtgtacagactcctggcttatggaatgaactcgaatcatgaggatgggagttagccac
atagactaatgctgtctttttgggagctgttaacccttaattcaatttttcccctttcag
ACTCAGTGGAGAAGGAGTTGGACCAGTCAACATCT
gtaagtagctttgaacagacattaacaacgacaataatatgggatatatttagtgccaac
tcagaattctgctgtttctagatccaaacttttcccatcccagcatatggttatttataa
taatacacttagtaagttgtgggtggtggaggggaaggacagattgggacaggaagcaat

Exon 10 +       6420       6718   1   Terminal    299    74        Good
cctcttacactcacccacttttttagggaccttaattaaatgacagttcttccgggcctt
gtttgctactctgtaaagggggtccagtagagtgctccaacaccagcagatcaaataaat
gggccatgcaggatcagcctggcagatggtctcactgagtcctccctcctttccctgcag
CTGTTGTCACAAGCAGTGTTTCCTCTGGATATGGCAGTGGCAGTGGCTATGGCGGTGGCC
TCGGTGGAGGTCTTGGCGGCGGCCTCGGTGGAGGTCTTGCCGGAGGTAGCAGTGGAAGCT
ACTACTCCAGCAGCAGTGGGGGTGTCGGCCTAGGTGGTGGGCTCAGTGTGGGGGGCTCTG
GCTTCAGTGCAAGCAGTGGCCGAGGGCTGGGGGTGGGCTTTGGCAGTGGCGGGGGTAGCA
GCTCCAGCGTCAAATTTGTCTCCACCACCTCCTCCTCCCGGAAGAGCTTCAAGAGCTAA
gaacctgctgcaagtcactgccttccaagtgcagcaacccagcccatggagattgcctct
tctaggcagttgctcaagccatgttttatccttttctggagagtagtctagaccaagcca
attgcagaaccacattctttggttcccaggagagccccattcccagcccctggtctcccg

--------------------------------------------------------------------------------