--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (26358 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (27 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1224       1441   0    Initial    218    74        Good
gggacgcgggctcagagttccagggacccaggaatgcccccccgccagccccctcggcag
gcggggggagggctcagccgggagtttggcaaactcctccccgcgttgagtcattcgcct
ctgggaggtttaggaagcggctccgggtcggtggccccaggacagggaagagcgggcgct
ATGGGGAGCCGGACGCCAGAGTCCCCTCTCCACGCCGTGCAGCTGCGCTGGGGCCCCCGG
CGCCGACCCCCGCTGCTGCCGCTGCTGTTGCTGCTGCTGCCGCCGCCACCCAGGGTCGGG
GGCTTCAACTTAGACGCGGAGGCCCCAGCAGTACTCTCGGGGCCCCCGGGCTCCTTCTTC
GGATTCTCAGTGGAGTTTTACCGGCCGGGAACAGACGG
gtgagtgaggagggctggagacgggatgggggtgggggagccgcctggagactgggggcg
cggctggggtctggaggggaccagggcttaagtttgagggtggagtttgtaaggaataga
gctgcagttgggggccctggctagagttgggggcccgcgctggagtagggagggcaccgt

Exon  2 +       8458       8588   2   Internal    131    64    Marginal
cgcctgactccagcctgtgcctctggcatctgtggcatcttctgagatataaatacaacg
cagggggcatctactccacccccagccagccccagcctagaggcctgggtccttcctgcc
tccagacaccaatgaaaagctaggagccatcctcaactgcctcgcttttcccccccacag
GGTCAGTGTGCTGGTGGGAGCACCCAAGGCTAATACCAGCCAGCCAGGAGTGCTGCAGGG
TGGTGCTGTCTACCTCTGTCCTTGGGGTGCCAGCCCCACACAGTGCACCCCCATTGAATT
TGACAGCAAAG
gtaggccagtgaaattcagggagggactggggggtgggactgcagcctgggggcaaggcc
tgggtggggcctggggcgaggggtggagcctgctggaaccccggccacgtgacctctcag
caccagctctggtgctccaactgcttacagtggatccccatggcactcactccactctcc

Exon  3 +      10861      10937   1   Internal     77    95   Excellent
ccttaccaattccacactcccagcgagtcatggagtctcagggcttggaagcgtttgttg
ggtatccccaggctgagggtaggggctgccctagagctcaaatgtccatggctcagtaag
actcccccttctcacttccacaaggctctcggctcctggagtcctcactgtccagctcag
AGGGAGAGGAGCCTGTGGAGTACAAGTCCTTGCAGTGGTTCGGGGCAACAGTTCGAGCCC
ATGGCTCCTCCATCTTG
gtgaggggccagcaagctcagtggtgtggtggccaggggatgggcagtggttgggtaagg
ccgggcctggagggagggaggaagggccttattggactgaatctgaaggcccctcctcct
gggccctcccaggcatgcgctccactgtacagctggcgcacagagaaggagccactgagc

Exon  4 +      11070      11190   0   Internal    121   100   Excellent
ttgcagtggttcggggcaacagttcgagcccatggctcctccatcttggtgaggggccag
caagctcagtggtgtggtggccaggggatgggcagtggttgggtaaggccgggcctggag
ggagggaggaagggccttattggactgaatctgaaggcccctcctcctgggccctcccag
GCATGCGCTCCACTGTACAGCTGGCGCACAGAGAAGGAGCCACTGAGCGACCCCGTGGGC
ACCTGCTACCTCTCCACAGATAACTTCACCCGAATTCTGGAGTATGCACCCTGCCGCTCA
G
gtaggggcaagagggggcctgtgccccatgtctgccttctcatatacttgaagtgtctca
catacttagggttgactcgcacctaccatgtgcccccatgaggttctaggttgcttaaga
taaaggctaacccagttcgttagcctttatgcttactgtctggtccaggaaggccctttc

Exon  5 +      11468      11529   1   Internal     62    93   Excellent
atgaggttctaggttgcttaagataaaggctaacccagttcgttagcctttatgcttact
gtctggtccaggaaggccctttctctggttctctctcccacctccttccctatgccctct
cttctttcctggatgacccatctatgcagggctcattttcaccaccttctcccctcacag
ATTTCAGCTGGGCAGCAGGACAGGGTTACTGCCAAGGAGGCTTCAGTGCCGAGTTCACCA
AG
gtgagagagtggtctgggagagaaggggccgtgggtggtggacatggggggattgggacc
agatgttggactcccctcctttcacccacagactggccgtgtggttttaggtggaccagg
aagctatttctggcaaggtaagtcctgtctctgccattcttttttttttttttttttttt

Exon  6 +      12192      12312   0   Internal    121   100   Excellent
cctcccaccctactcccaattctcctcttcctttcctgaagcttacatgccaccaccctc
cccatgcttccctttcttgaaccagacttctgaaatactacccagtcagcccccagagtc
ccaagccccctctgccacttcctctccatctactccctcttcatactctctccaggccag
ATCCTGTCTGCCACTCAGGAGCAGATTGCAGAATCTTATTACCCCGAGTACCTGATCAAC
CTGGTTCAGGGGCAGCTGCAGACTCGCCAGGCCAGTTCCATCTATGATGACAGCTACCTA
G
gtgagcaagcaagtggggaagggatggcagagggagaacctcaagtgctcctgtccccac
tcaccccctcgcctcccctctcctactcaggcatccccagcacccctgccatacttgtca
tgtgcctgctgactatgaaggcccagtaggggtggggaagggattggtggataggccaga

Exon  7 +      12546      12590   1   Internal     45    96   Excellent
tccccactcaccccctcgcctcccctctcctactcaggcatccccagcacccctgccata
cttgtcatgtgcctgctgactatgaaggcccagtaggggtggggaagggattggtggata
ggccagagcagaggggtcctcaaagcaggaatcctaacatccacccaccctgtcccccag
GATACTCTGTGGCTGTTGGTGAATTCAGTGGTGATGACACAGAAG
gtgagtgtgtccccaggctggggccaagggagggggatggttagaggcacagggccagag
agcccatgaacttggccacttaccattatctgcttccctttccccacccttaggtcacaa
ctttctcttctctttgcagactttgttgctggtgtgcccaaagggaacctcacttacggc

Exon  8 +      12730      12773   1   Internal     44    78        Good
ctctgtggctgttggtgaattcagtggtgatgacacagaaggtgagtgtgtccccaggct
ggggccaagggagggggatggttagaggcacagggccagagagcccatgaacttggccac
ttaccattatctgcttccctttccccacccttaggtcacaactttctcttctctttgcag
ACTTTGTTGCTGGTGTGCCCAAAGGGAACCTCACTTACGGCTAT
gtaagacccagcctgacccctcacttcctctcctcccctgcctaatcacaaagaaccgtg
catggcagtttgcaagggctcaaaaaggtggatcagaacatgggctctggaggcagactg
gcattcaagttctggcacttactctggcagaatcattctgctctttattcatactctgct

Exon  9 +      13573      13764   0   Terminal    192    54    Marginal
atgagaacactgaggttctaagagaccaagtaagttgcttaagatcacccagttagtaag
taggtttaaaatcaggtctctcttaatccaaaatcagcattctttctgcattttggtaaa
cttcagcaaagtggatacagtggcatagcagtttaggggaaagaataatctcctttctag
GAAAAGGATGGTAACAAGTTTGGGGAGTCAGGAAATAAAAATTTTAAATTTTTAAAAAGG
AAGAGGACAGATGAGAGAAGGTTCTATGAAGGTTCAGCAGAGATGAGGCAGGAGGGCATC
CTGTGCAGGAGCATGAATGAGGTGGAAGAAAAGGAAACAATTTCAGCCCAACTTAGCAGA
CTCATGAGCTGA
ttgaggatgagtagaatatggaaaggttgagcaaaaacagataggttagggccagattct
ccagagctttggaggaccagccaagaagttgagactttgggcagtgactgcagggggcca
ctggatttccaagccagaggtagcctcctagatctgctgggagagctggaggcagggaca

Exon 10 +      14496      14552   0   Internal     57    96   Excellent
tagggtggaactacctggcatagaggtgggaatatgagggcaaagctgaagagggagcta
gggacagtggtctgcgtctctaaggaatgcctgcccctgggtgtcctgtacacatctgtt
ctttaaccatgggatattctgggagtccaggaccaatgggcctatctcttcatctcccag
GTCACCATCCTTAATGGCTCAGACATTCGATCCCTCTACAACTTCTCAGGGGAACAG
gtaaggatacccctcaaccccaccccagcttggcctctgtcaacgaagccccagccctga
cctaataatgtcagcccaacttcccagcccctcttgatcctgtggattgaaccttctagt
tctgacccagcgctgcccctttgtcctccccagatggcctcctactttggctatgcagtg

Exon 11 +      14706      14758   0   Internal     53    84        Good
tccctctacaacttctcaggggaacaggtaaggatacccctcaaccccaccccagcttgg
cctctgtcaacgaagccccagccctgacctaataatgtcagcccaacttcccagcccctc
ttgatcctgtggattgaaccttctagttctgacccagcgctgcccctttgtcctccccag
ATGGCCTCCTACTTTGGCTATGCAGTGGCCGCCACAGACGTCAATGGGGATGG
gtgagtggtgggaaatgagcgcactgtgataccctcccagaaccaagagggaagagtggg
aatgggacagaaaatgcaaggagagtttctccagggctttttctctagactctcgctcat
acctgcattccccttgctcagggacaaggaaagagctgagagctgatgatcagagacctc

Exon 12 +      15048      15256   2   Internal    209   100   Excellent
ctctcgctcatacctgcattccccttgctcagggacaaggaaagagctgagagctgatga
tcagagacctcaggtcttctgacgtgatggaattcagagtgtccgggatttctagcacta
ggattggggtggggtggcaagacagggtatcgagatgcctgggtttgcccttcccctcag
GCTGGATGACTTGCTGGTGGGGGCACCCCTGCTCATGGATCGGACCCCTGACGGGCGGCC
TCAGGAGGTGGGCAGGGTCTACGTCTACCTGCAGCACCCAGCCGGCATAGAGCCCACGCC
CACCCTTACCCTCACTGGCCATGATGAGTTTGGCCGATTTGGCAGCTCCTTGACCCCCCT
GGGGGACCTGGACCAGGATGGCTACAATG
gtgagtaccatgggctcagagagtgaaagaggaggcaggggcccaagtcagaagggattt
ggggagagggcatctgtcagctaagatacccagacctccacgacttcccgaggggttaaa
atcccactgtctgggtcttgggatttgaagattagaatatagggactgacagatgggaaa

Exon 13 +      15528      15719   1   Internal    192   100   Excellent
agacctccacgacttcccgaggggttaaaatcccactgtctgggtcttgggatttgaaga
ttagaatatagggactgacagatgggaaaaaataggatcctaggtcctggggtctggtag
tagagattagagcccatggattcctggcctgctgactagtgtgtgttctgtgtcttccag
ATGTGGCCATCGGGGCTCCCTTTGGTGGGGAGACCCAGCAGGGAGTAGTGTTTGTATTTC
CTGGGGGCCCAGGAGGGCTGGGCTCTAAGCCTTCCCAGGTTCTGCAGCCCCTGTGGGCAG
CCAGCCACACCCCAGACTTCTTTGGCTCTGCCCTTCGAGGAGGCCGAGACCTGGATGGCA
ATGGATATCCTG
gtgagttgtgcctgaggccccttttcaccttaaaattccctggtcactgacccctactct
ctcttctgcacctttccttaagttcctgggtgcagttctggctaattccaacagagggcg
ctgtcttctcacttcaacctccctgagcgttgaaaccaggaggggttaggaagaaaggat

Exon 14 +      16176      16277   2   Internal    102   100   Excellent
tgagctccaaagggagatgaggggacaacctgggtggactggaactggaaatttctcaac
agagctgaggttgggaaaatcaatgcagaggacacacattctggcgcttgggcatcagtt
tcctgtgtccaggttacagaggagtcctaattctattgaccccacattcactcttggcag
GGGCCGCCCCATCGTGTCCGCTAGTGCCTCCCTCACCATCTTCCCCGCCATGTTCAACCC
AGAGGAGCGGAGCTGCAGCTTAGAGGGGAACCCTGTGGCCTG
gtgagctggtgcccaggaaattgcagagacctgagcctgggagtgggcaggggcaccaag
tctgccttaaaaaggggaaaatggtggtgtcctagtctgggtctggctgggagataggta
gaggataggatgtctgttccagttggattcaccagctttcttcttggtctctctccagca

Exon 15 +      16456      16511   2   Internal     56    97   Excellent
tggtgagctggtgcccaggaaattgcagagacctgagcctgggagtgggcaggggcacca
agtctgccttaaaaaggggaaaatggtggtgtcctagtctgggtctggctgggagatagg
tagaggataggatgtctgttccagttggattcaccagctttcttcttggtctctctccag
CATCAACCTTAGCTTCTGCCTCAATGCTTCTGGAAAACACGTTGCTGACTCCATTG
gtgagggagactgcctggatctctcaggccctaggacagagaatgaagggactggggacc
tggggacatttcttctctctgaaaagatgaggaaagacaggcagtttccctttatatgtc
cctggcttcaggtttcacagtggaacttcagctggactggcagaagcagaagggaggggt

Exon 16 +      16643      16797   1   Internal    155    99   Excellent
cttagcttctgcctcaatgcttctggaaaacacgttgctgactccattggtgagggagac
tgcctggatctctcaggccctaggacagagaatgaagggactggggacctggggacattt
cttctctctgaaaagatgaggaaagacaggcagtttccctttatatgtccctggcttcag
GTTTCACAGTGGAACTTCAGCTGGACTGGCAGAAGCAGAAGGGAGGGGTACGGCGGGCAC
TGTTCCTGGCCTCCAGGCAGGCAACCCTGACCCAGACCCTGCTCATCCAGAATGGGGCTC
GAGAGGATTGCAGAGAGATGAAGATCTACCTCAGG
gtatggcccagagggcggggtgtggactggccagggagggtggccacacagaactgaggg
cacctcctgaagggaaaaagactgggggactccagtgaagggcttgggactcttgtaggg
gctgagaaagggagaccttctgtcagaggagctgggaagcaggctgccagggcctctgaa

Exon 17 +      17098      17235   0   Internal    138    94   Excellent
gctgagaaagggagaccttctgtcagaggagctgggaagcaggctgccagggcctctgaa
acaatgaggatggtcggaattgggccctaagcagacaaagggagatgagagaggctgagg
agcagggccactaagtctccagagtcccctgactccgtgaactctctcctctggccccag
AACGAGTCAGAATTTCGAGACAAACTCTCGCCGATTCACATCGCTCTCAACTTCTCCTTG
GACCCCCAAGCCCCAGTGGACAGCCACGGCCTCAGGCCAGCCCTACATTATCAGAGCAAG
AGCCGGATAGAGGACAAG
gtgaggacagggcagggagaagggacctgggaagacagaggcctgggtattgggggggca
gggccatggaaagagaagagcctacagcccaggaatgggtctaaacttcccctctcaagg
ctgccctgctccccaggctcagatcttgctggactgtggagaagacaacatctgtgtgcc

Exon 18 +      17372      17439   0   Internal     68   100   Excellent
ggccagccctacattatcagagcaagagccggatagaggacaaggtgaggacagggcagg
gagaagggacctgggaagacagaggcctgggtattgggggggcagggccatggaaagaga
agagcctacagcccaggaatgggtctaaacttcccctctcaaggctgccctgctccccag
GCTCAGATCTTGCTGGACTGTGGAGAAGACAACATCTGTGTGCCTGACCTGCAGCTGGAA
GTGTTTGG
gtaagtagggctgacggtaagctagggagctccaggtgcacctggcacctgaaaaaatca
gctagggacatactagctgtgtcgccttgggaagttgctgagctgctctgagctttaact
cctttgtctgtatagtgggaatagtagcatttatttctcagactttttggaaagattaaa

Exon 19 +      18092      18242   2   Internal    151   100   Excellent
cttggccaggcttgtcttgaactcctgacctcgtgatccacccgcctcagcctcccaaag
tgctgggattacaggtgtgagccaccacacccggcctcgtattactactcttataatggt
cctttgtcctggtttgaggattaattcaccaatgtcccttaccctctgtgtcccttccag
GGAGCAGAACCATGTGTACCTGGGTGACAAGAATGCCCTGAACCTCACTTTCCATGCCCA
GAATGTGGGTGAGGGTGGCGCCTATGAGGCTGAGCTTCGGGTCACCGCCCCTCCAGAGGC
TGAGTACTCAGGACTCGTCAGACACCCAGGG
gtgagatgagactctcgagtgggatttgggaggatacccctctagaggggacaccaaaac
ctgaccagtgcccaccccatctccagaacttctccagcctgagctgtgactactttgccg
tgaaccagagccgcctgctggtgtgtgacctgggcaaccccatgaaggcaggagccagtg

Exon 20 +      18329      18421   0   Internal     93    97   Excellent
ccagaatgtgggtgagggtggcgcctatgaggctgagcttcgggtcaccgcccctccaga
ggctgagtactcaggactcgtcagacacccaggggtgagatgagactctcgagtgggatt
tgggaggatacccctctagaggggacaccaaaacctgaccagtgcccaccccatctccag
AACTTCTCCAGCCTGAGCTGTGACTACTTTGCCGTGAACCAGAGCCGCCTGCTGGTGTGT
GACCTGGGCAACCCCATGAAGGCAGGAGCCAGT
gtaagtttgggatgaaagaggatgggacagagggagagcagacctgagggcggtaaccag
ccagccgagagcacagctgtgaggtgcggagggagggtgaaatacacagtctaactgccc
tcttttcctctttttctgtccccagctgtggggtggccttcggtttacagtccctcatct

Exon 21 +      18567      18646   0   Internal     80   100   Excellent
gtgacctgggcaaccccatgaaggcaggagccagtgtaagtttgggatgaaagaggatgg
gacagagggagagcagacctgagggcggtaaccagccagccgagagcacagctgtgaggt
gcggagggagggtgaaatacacagtctaactgccctcttttcctctttttctgtccccag
CTGTGGGGTGGCCTTCGGTTTACAGTCCCTCATCTCCGGGACACTAAGAAAACCATCCAG
TTTGACTTCCAGATCCTCAG
gtagggagtgagtgtgtctaggctggggctgagctggggacggaagggagggctgggcgc
cattctcactggctgcactccagcacctcagtcttgcctccatcccacagcaagaatctc
aacaactcgcaaagcgacgtggtttcctttcggctctccgtggaggctcaggcccaggtc

Exon 22 +      18757      18837   2   Internal     81    96   Excellent
gccttcggtttacagtccctcatctccgggacactaagaaaaccatccagtttgacttcc
agatcctcaggtagggagtgagtgtgtctaggctggggctgagctggggacggaagggag
ggctgggcgccattctcactggctgcactccagcacctcagtcttgcctccatcccacag
CAAGAATCTCAACAACTCGCAAAGCGACGTGGTTTCCTTTCGGCTCTCCGTGGAGGCTCA
GGCCCAGGTCACCCTGAACGG
gtcagtgccaggcaaaatggggtctttctgagaggggacacagacttctagggaaggatg
catatggggttccttccaccctcctctaaaccaccctcctccttagtgtctccaagcctg
aggcagtgctattcccagtaagcgactggcatccccgagaccagcctcagaaggaggagg

Exon 23 +      18944      19049   2   Internal    106    69    Marginal
ctcaacaactcgcaaagcgacgtggtttcctttcggctctccgtggaggctcaggcccag
gtcaccctgaacgggtcagtgccaggcaaaatggggtctttctgagaggggacacagact
tctagggaaggatgcatatggggttccttccaccctcctctaaaccaccctcctccttag
TGTCTCCAAGCCTGAGGCAGTGCTATTCCCAGTAAGCGACTGGCATCCCCGAGACCAGCC
TCAGAAGGAGGAGGACCTGGGACCTGCTGTCCACCATGTCTATGAG
gtaaggggggaaggggcagggccagaatgaatgatgggaaaggaggagctaatatgagtg
acagatggctggaacccatgtgagggactgagagaaagagaggagggaggagtaagtgat
atgcaaaggcatgaggcagagtcctgtgagaaacagccagaggagagacaggccaattga

Exon 24 +      19427      19576   0   Internal    150   100   Excellent
atggagccccctccaaaagtgttggctagagaggatttcacctctgcccattgcttccct
gcttcatctctgagataggagcctgacagcagggtatagtggagccatggtgatccaggg
tctcaatggggcagaagcattcccttccttctcatgatgattgtgctcttccctcctcag
CTCATCAACCAAGGCCCCAGCTCCATTAGCCAGGGTGTGCTGGAACTCAGCTGTCCCCAG
GCTCTGGAAGGTCAGCAGCTCCTATATGTGACCAGAGTTACGGGACTCAACTGCACCACC
AATCACCCCATTAACCCAAAGGGCCTGGAG
gtgagatcctgaacactggcatggggaagaggagcagattcagaggaccaaggctgaggg
gttggggaaggttgctgggggcctgcaagaggcaatgaggatgtgcctatagctagggtt
gagggtcacaaggcccaaagttacctcaaaatcctctggaggaaaaaggactttcatcca

Exon 25 +      20664      20777   0   Internal    114    98   Excellent
gagggttccctgcaccaccagcaaaaacgggaagctccaagccgcagctctgcttcctcg
ggacctcagatcctggtaagtcaggcagggaatgaggtgtggaccaaagtgttgagtact
ctggggttctcagggccatcacaagggcagaacaccaggttcaagcttctttcttcctag
AAATGCCCGGAGGCTGAGTGTTTCAGGCTGCGCTGTGAGCTCGGGCCCCTGCACCAACAA
GAGAGCCAAAGTCTGCAGTTGCATTTCCGAGTCTGGGCCAAGACTTTCTTGCAG
gtgagggagccttacctcagccctgacccctgacctttgggcctgcttagactgacccac
ccctttctccactgcagtagccacctctcctttggtgaatgggacccagcactccagctc
cccttccttgcccttgtctagaccaggctgtatgtccttggcgccatctagtggccacag

Exon 26 +      21724      21825   0   Internal    102    77        Good
gacagagtgagacctagtctcaaaaaaaaaaaaaaaaaaaaaagagagagagagagagag
agactcaggaagaatgagcccaaaatagggaaagatcacaaccccagccagacgatgggg
aaccctatgtcctctggatcccaagagaggatgtgctaaccaactttcccctacccacag
CGGGAGCACCAGCCATTTAGCCTGCAGTGTGAGGCTGTGTACAAAGCCCTGAAGATGCCC
TACCGAATCCTGCCTCGGCAGCTGCCCCAAAAAGAGCGTCAG
gtgagtctagggccagaggactggatgagggaatacagggctcagagtgctggaacaggg
ctgggacttgggtgagggctggccttggtattgttaacaactgttgagaatgtactatgt
gccaagcactgtgcagatgccagagacagagtggtaagcaagatcaacatggtatctttg

Exon 27 +      22935      23234   0   Terminal    300    99   Excellent
cctgaaggggccatgatggcaacagatctggaacctcagcctggccagacacaggccctc
cctgttccccagagaaaggggagcccactgggctctgcagatccaatgacaagtgggggc
caagtatagggtagaaagaacttctgagctttcattgacttcacccaacttgctccccag
GTGGCCACAGCTGTGCAATGGACCAAGGCAGAAGGCAGCTATGGCGTCCCACTGTGGATC
ATCATCCTAGCCATCCTGTTTGGCCTCCTGCTCCTAGGTCTACTCATCTACATCCTCTAC
AAGGTCAGCCACATCCTGCTTGTGACTTGGCCACCCTCTCATCAGGCTCTGCCCTTGACC
TGGCACAGTCCCAAGTATCTACCTCTAGACCAGTTCACCAGCCATGTGCCCCCACCTCTG
TCCTGGCTACATGCATCCCATCCTAACCCTTCCTATAAGATCCCCCCCTTCATTCTATAG

cccctagcttagaaagggtcctcttgactcaagatgataagtttgcctatacttgcaaaa
tcattggaacccaaagatgacaaatacgtggcatttgtgctgtcaatttctccaaaaatc
catggcagccatcactaacctagaaatggctactgatcatctcctagaagtggcttcaga

--------------------------------------------------------------------------------