--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (8229 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (8 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1227       1267   0    Initial     41    89        Good
cccctgtctctcctttccctggctctgccagactctctatctccctgggcgccagcctcc
ccacccacccctggagggcggggcttggctgcacccacgtgtggtggagttaaatgctcc
tagccggcagaggagctagggagtgtggcactgagccggctcaggcagagacgcggcacc
ATGGCTAGCAAGAAAGTCTGCATTGTAGGCTCCGGGAACTG
gtaagcagctctgtcaagtgatatgggggaagggtaggccccccaagacagaggtgggta
ggaggcagaatgggtgggaaaggccctcaggttcctgttcagcccctgctgctatcttct
atcatagcagcacaggacagacggtgcccggccctctcctgacccccgccctcctgggca

Exon  2 +       1750       1927   2   Internal    178   100   Excellent
gagtctcctttctactgccaggtcactggggactatttgtcatgggagtggaggtgataa
ggaaggtaggtaggagtgaacagcctggggggctgctgtgagatcctgaggtggggcgct
gccccaactcctgccactgttccctcctcctgtactttcctgtgctccccctcccaccag
GGGCTCAGCCATCGCCAAGATCGTGGGTGGCAATGCAGCCCAGCTGGCACAGTTTGACCC
ACGGGTGACCATGTGGGTATTTGAGGAAGACATTGGAGGCAAAAAGCTGACTGAGATCAT
CAACACGCAGCATGAGAATGTCAAATACCTGCCAGGGCACAAGTTGCCCCCAAATGTG
gtgagccccaacaccctgcgaagaacagggagaggaagggagggccaggagttggagccg
accttactcaacaggtgcctcctgctgagagggccgcttcaggtgcagcaggacttggga
aggtctcaggagggctgctctgggccctttcctgaggactgaggagaacctatgctttcc

Exon  3 +       2724       2864   0   Internal    141    96   Excellent
gctggggggagggagtagagtgtcttattcctccaagttcagtccttctagattcagtcc
caaacaagccttcctgctcccctaccagcctcactctttggctcccagatctcctgaata
gggttccacaggggctaggggaggtctgccaggcccgcgagcacttggtcacccccacag
GTGGCTGTCCCAGATGTGGTCCAGGCTGCAGAGGATGCTGACATCCTGATCTTTGTGGTG
CCCCATCAGTTCATCGGCAAGATCTGTGACCAGCTCAAGGGCCATCTGAAGGCAAACGCC
ACTGGCATATCTCTTATTAAG
gtgccagggacaccttcatgtggatgggggagggtgcggctcactgttgtggggttcagg
gtgggtgaagcaaggagaacagaaaatggcagacgcaggccaagagtttgctggagaaaa
gagaggcagttggctctggagaggcttaggaaagcagtgaggtgctgggggtcactggaa

Exon  4 +       3464       3602   0   Internal    139   100   Excellent
aggacagttggtcacatgctgtctggcctcctcacagcaaacttgagctgggttggaatg
gggcaggacctgtcgggagggacacagatgagcaatggatttggaagggacagaatttct
gggcggaagcccgcaggtgggcccaaagggcacctggcctgagctccatcctgtgctcag
GGGGTAGACGAGGGCCCCAATGGGCTGAAGCTCATCTCGGAAGTGATTGGGGAGCGCCTC
GGCATCCCCATGAGTGTGCTGATGGGGGCCAACATTGCCAGCGAGGTGGCTGATGAGAAG
TTCTGTGAGACAACCATTG
gtgagagccccctggcacctgcatacacagtgcatctagttgcatcccctccccaaactg
ccccaaccccacttagccatctctttcccataaggcagagaaaggaaaatacaagcatca
gaggtgaaggaggctgggacacccccagggaaggggcttcagggcctgcttagggaaaca

Exon  5 +       3981       4121   1   Internal    141   100   Excellent
cagagttggtgcagtggcacacctgtggtcccagctacttaagaggctgaggtgggagga
tcgcttaagcccaggagtttgagtccagcctgggcaacagagagagactcccatctctat
aaaataaatattttttaaaaagagtccttccctcaaagccttgccccctcctcactttag
GCTGCAAGGACCCGGCCCAGGGACAACTCCTGAAAGAGCTGATGCAGACACCAAACTTCC
GTATCACAGTGGTGCAAGAGGTGGACACAGTAGAGATCTGTGGAGCCTTAAAGGTGAGAG
GGGCACAGAGGCAGCTATGGG
gtgaggagaaggccccaaaggaggtctggctgagctctgcaaggctgcaggtactccagg
ctctcactattgagcagtggttcccctttcctaccatgtcccatgcatataggaggagct
gcagaagcaaggccagggccattcaggccggctgattattcatcatcagaccgtggaccc

Exon  6 +       4750       4976   1   Internal    227    83        Good
aagggggtgcagcaaggggggaaaccaagaggcggaagtaggcttctaaaaggccacaca
ctatacctctcttctgcagtgggtgtcacggctgatgaaatgagtatgagggggctccac
atggggcctataggagggggtcttttctcacctatgacctccactccttcaagaatgtag
TGGCCGTGGGGGCTGGCTTCTGTGATGGCCTGGGCTTTGGCGACAACACCAAGGCGGCAG
TGATCCGGCTGGGACTCATGGAGATGATAGCCTTCGCCAAGCTCTTCTGCAGTGGCCCTG
TGTCCTCTGCCACCTTCTTGGAGAGCTGTGGTGTTGCTGACCTGATCACTACCTGCTATG
GAGGGCGGAACCGGAAAGTGGCTGAGGCCTTTGCGCGTACAGGAAAG
gtgggccccgggagaagggagaacagaggggcggctctgtaggcatccaggtagaggtgc
ttggcgggaggcatctctggagcacaaacattaagactgttgtgcacatccccatccctc
ttttcctcccaagaccccactcccatctgagctccagtctctccaccccctactgacaac

Exon  7 +       5200       5306   0   Internal    107   100   Excellent
catccaggtagaggtgcttggcgggaggcatctctggagcacaaacattaagactgttgt
gcacatccccatccctcttttcctcccaagaccccactcccatctgagctccagtctctc
caccccctactgacaacccttctctcccatttccatccactcatcctgttttctgcacag
TCCATTGAGCAGCTGGAGAAAGAGTTGCTGAATGGGCAGAAACTGCAGGGGCCCGAGACA
GCCCGGGAGCTATACAGCATCCTCCAGCACAAGGGCCTGGTAGACAA
gtaagtattggccacagccccactgattaagggagccacagccagaagtgctcgccctgt
tcatcatcttcctaaacctgccacaaatctgtgaagtggacagaaaggggagtattacct
tacatttcagacagagtccagagcttgcagagtctggcatgcccattgtccgccagctag

Exon  8 +       6599       6691   2   Internal     93   100   Excellent
atctgaccttaaacctagggctagggagttcacattctcagaaggtagaaactcacagcc
atccttcctgagctccaaggtgggagggcaagggacaggagggttaggcagtgagtgggg
gtgggggtagagtggaccaggagtgggaggctaagctgagcctttccctctccaatctag
GTTTCCCTTGTTCATGGCTGTGTACAAGGTGTGCTACGAGGGCCAGCCAGTGGGTGAATT
CATCCACTGCCTGCAGAATCATCCAGAACATAT
gtgagtggggccagggcccaggccaggccgcttttttaccccagtggagaccagcagaag
cctggggtacctagtcaccaggatctccaggactcccagggagcagagtcttctcatctt
ttcactggaggacaggaggctatggggcccagctacgcacctggagatcctgaactgtca

--------------------------------------------------------------------------------